>6m0x_B mol:na length:71  RNA (71-MER)
GGUGCUAAGAUUAAUCAGGAUGUUUUUGUACUCGAAAGAAGCUACAAAGAUAAGGCUUC
AUGCCGAAAUCA