>6m6a_T mol:na length:63  template strand DNA
GGGTATTCGCCGTGTACCTCTCCTAGCCCAACCATATGGATTATTAAGCAAAGCTTCTT
TTCG