>6m6c_N mol:na length:63  nontemplate strand DNA
CGAAAAGAAGCTTTGCTTAATAATCCATATGGTTGGGCTACCTCTCCATGACGGCGAAT
ACCC