>6ml4_E mol:na length:20  DNA (5'-D(*AP*CP*GP*CP*AP*GP*GP*TP*CP*CP*TP*GP*GP*AP*CP*GP*AP*AP*GP*C)-3')
ACGCAGGTCCTGGACGAAGC