>6ml4_F mol:na length:20  DNA (5'-D(*TP*GP*CP*TP*TP*CP*GP*TP*CP*CP*AP*GP*GP*AP*CP*CP*TP*GP*CP*G)-3')
TGCTTCGTCCAGGACCTGCG