>6muo_I mol:na length:147  DNA/RNA (147-MER)
ATCAAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAG
GCATGTTCAGCTCTGTGAGTGAAACTCCATCATCACAAAGAATATTCTGAGAATGCTTC
CGTTTGCCTTTTATATGAACTTCCTCGAT