>6o0z_C mol:na length:40  target strand DNA
CTAATCGCCAGCGTCTCATCTTTATGCGCCTACGCACTGG