>6oy6_H mol:na length:27  DNA (5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*GP*AP*TP*CP*TP*GP*AP*TP*GP*CP*AP*GP*G)-3')
TATAATGGGAGCTGGATCTGATGCAGG