>6p19_1 mol:na length:123  DNA (123-MER) fragment carrying phage-21 pR' promoter, pause element, and transcribed region, nontemplate strand
CGTGTTGACATCATTGAGCAAATGAGCAACACTATTCGCATAAGGTGGAGTTAGTGAGT
GTTAAGTTGGAAGGGTGGGATTTAAATTTTGGGTGAGTGGTGGAGAGGTACCTCGTTGT
GGTAG