>6p1a_D mol:na length:21  DNA (5'-D(P*CP*TP*CP*AP*TP*TP*GP*AP*GP*CP*AP*AP*AP*TP*GP*AP*GP*CP*AP*AP*G)-3')
CTCATTGAGCAAATGAGCAAG