>6pax_B mol:na length:26  26 NUCLEOTIDE DNA
AAGCATTTTCACGCATGAGTGCACAG