>6pb4_2 mol:na length:78  SYNTHETIC TEMPLATE STRAND DNA (78-MER)
CGCCGCGTCAGACTCGTAGGATTATAGCATAAAAAAGATGCGAAAAATGTGATCTAGAT
CACATTTTAGGCAAAAAAG