>6pss_O mol:na length:85  DNA (85-MER)
GGCGGCGCTTATTTGCACAAATCCATTGACAAAAGAAGGCTAAAAGGGCATATACCTCG
GCCTTTGAATTGTCCATATAGAACGC