>6pst_P mol:na length:85  DNA (85-MER)
GCGTTCTATATGGACAATTCAAAGGCCGAGGAATGCGCCCTTTTAGCCTTCTTTTGTCA
ATGGATTTGTGCAAATAAGCGCCGCC