>6qx2_w mol:na length:20  DNA (5'-D(*GP*AP*GP*CP*GP*TP*AP*CP*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP*T)-3')
GAGCGTACGGCCGTACGCTT