>6r93_I mol:na length:145  Human alpha-satellite DNA (145-MER)
ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCAACCAAAAGG
CATGTTCAGCTGGTTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTT
TGGTAGAATCTGCAGGTGGATATTGAT