>6ri7_N mol:na length:39  Non-template DNA
GGTCAGTACGTCCCGTCGATCTTCGGAAGAGATTCAGAG