>6ri7_T mol:na length:39  Template DNA
CTCTGAATCTCTTCCAGCACACATCGGGACGTACTGACC