>6rin_N mol:na length:39  Non-template DNA
GCACATCACCCATTCAGAAGCTAAGGCATGGCTAGCTGC