>6u17_C mol:na length:28  DNA (28-MER)
CAGCTCTGTACGTGAGCGATGGACAGCT