>6uit_T mol:na length:27  DNA template
ATGGGGGGCGCCCGAACAGGGACTGTG