>6ujz_P mol:na length:21  primer DNA
ACAGTCCCTGTTCGGGCGCCC