>6ujz_T mol:na length:27  template DNA
ATGGGGGGCGCCCGAACAGGGACTGTG