>6wb0_C mol:na length:101  HIV-1 viral RNA genome fragment
GACUCUGGUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGUGUGGAAAAUCUCUAGCAG
UGGCGCCCGAACAGGGACUUGAAAGCGAAAGUAAAGCCAGAG