>6wpf_T mol:na length:27  DNA template 27-mer
ATGGACGGCGCCCGAACAGGGACTGTG