>6wz5_J mol:na length:167  DNA (153-MER)
CTATGATGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTA
GCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACT
CCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTG