>6yov_J mol:na length:300  DNA (142-MER)
ATCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGC
TTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGT
CTCCAGGCCTTTGTTATGCAAATACATCCTGTACAGGATGTATTTGCATAACAAAGGCC
TGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCG
TTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTGCAGACCGGGATTCTCC
AGGAT