>7c97_H mol:na length:63  DNA (63-mer)
AACAAAATGATTGACAAAAGTGTTAAATTGTGCTATAATGGGAGCTGTCACGGATGCAG
GGGA