>7crp_K mol:na length:187  DNA (168-MER)
ATCGCGACACCGGCACTGGAACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGG
AGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGC
TAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGGATCGGGC
ATCACCCGAT