>7k60_J mol:na length:197  DNA (197-MER)
GGGGTGGTCGCTGTTCAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGAC
TAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGC
GGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCGG
CCGCGTATAGGGTCCAGCCC