>7khc_Y mol:na length:63  DNA (63-MER)
AGTGGTGGCGCATTATAGGGAGTTATTCCGGCCTGACAAGAGGAAATTTAAAATAATTT
TCTG