>7khi_Y mol:na length:28  DNA (28-MER)
AGGGAGTTATTCCGGCCTGACAAGAGGA