#   1AM9 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.338 
PDB   1AM9         
RCSB  PDT062       
WWPDB D_1000170991 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1AM9 
_pdbx_database_status.recvd_initial_deposition_date   1997-06-25 
_pdbx_database_status.deposit_site                    BNL 
_pdbx_database_status.process_site                    NDB 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
'Parraga, A.'  1 ?                   
'Burley, S.K.' 2 0000-0002-2487-9713 
#                        primary 
_citation.title                     'Co-crystal structure of sterol regulatory element binding protein 1a at 2.3 A resolution.' 
_citation.journal_abbrev            Structure 
_citation.journal_volume            6 
_citation.page_first                661 
_citation.page_last                 672 
_citation.year                      1998 
_citation.journal_id_ASTM           STRUE6                   UK 
_citation.journal_id_ISSN           0969-2126 
_citation.journal_id_CSD            2005 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   9634703 
_citation.pdbx_database_id_DOI      '10.1016/S0969-2126(98)00067-7' 
primary 'Parraga, A.'         1 ?                   
primary 'Bellsolell, L.'      2 ?                   
;Ferre-D'Amare, A.R.
3 ?                   
primary 'Burley, S.K.'        4 0000-0002-2487-9713 
_cell.entry_id           1AM9 
_cell.length_a           94.630 
_cell.length_b           94.630 
_cell.length_c           459.100 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        120.00 
_cell.Z_PDB              48 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1AM9 
_symmetry.space_group_name_H-M             'P 61 2 2' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                178 
1 polymer     syn 
5289.417 2   ? ?     ?                    ? 
2 polymer     syn 
6361.140 2   ? ?     ?                    ? 
3 polymer     man 'PROTEIN (STEROL REGULATORY ELEMENT BINDING PROTEIN 1A)'                         9492.990 4   ? C404S 
4 non-polymer syn 'MAGNESIUM ION'                                                                  24.305   2   ? ?     ? ? 
5 water       nat water                                                                            18.015   299 ? ?     ? ? 
_entity_name_com.entity_id   3        SREBP-1A 
1 polydeoxyribonucleotide no no '(DT)(DT)(DG)(DC)(DA)(DG)(DT)(DG)(DG)(DG)(DG)(DT)(DG)(DA)(DT)(DC)(DT)'                  
TTGCAGTGGGGTGATCT                                                                     E,G     ? 
2 polydeoxyribonucleotide no no 
CATGAGATCACCCCACTGCAA                                                                 F,H     ? 
3 'polypeptide(L)'        no no 
A,B,C,D ? 
1 1  DT  n 
1 2  DT  n 
1 3  DG  n 
1 4  DC  n 
1 5  DA  n 
1 6  DG  n 
1 7  DT  n 
1 8  DG  n 
1 9  DG  n 
1 10 DG  n 
1 11 DG  n 
1 12 DT  n 
1 13 DG  n 
1 14 DA  n 
1 15 DT  n 
1 16 DC  n 
1 17 DT  n 
2 1  DC  n 
2 2  DA  n 
2 3  DT  n 
2 4  DG  n 
2 5  DA  n 
2 6  DG  n 
2 7  DA  n 
2 8  DT  n 
2 9  DC  n 
2 10 DA  n 
2 11 DC  n 
2 12 DC  n 
2 13 DC  n 
2 14 DC  n 
2 15 DA  n 
2 16 DC  n 
2 17 DT  n 
2 18 DG  n 
2 19 DC  n 
2 20 DA  n 
2 21 DA  n 
3 1  GLN n 
3 2  SER n 
3 3  ARG n 
3 4  GLY n 
3 5  GLU n 
3 6  LYS n 
3 7  ARG n 
3 8  THR n 
3 9  ALA n 
3 10 HIS n 
3 11 ASN n 
3 12 ALA n 
3 13 ILE n 
3 14 GLU n 
3 15 LYS n 
3 16 ARG n 
3 17 TYR n 
3 18 ARG n 
3 19 SER n 
3 20 SER n 
3 21 ILE n 
3 22 ASN n 
3 23 ASP n 
3 24 LYS n 
3 25 ILE n 
3 26 ILE n 
3 27 GLU n 
3 28 LEU n 
3 29 LYS n 
3 30 ASP n 
3 31 LEU n 
3 32 VAL n 
3 33 VAL n 
3 34 GLY n 
3 35 THR n 
3 36 GLU n 
3 37 ALA n 
3 38 LYS n 
3 39 LEU n 
3 40 ASN n 
3 41 LYS n 
3 42 SER n 
3 43 ALA n 
3 44 VAL n 
3 45 LEU n 
3 46 ARG n 
3 47 LYS n 
3 48 ALA n 
3 49 ILE n 
3 50 ASP n 
3 51 TYR n 
3 52 ILE n 
3 53 ARG n 
3 54 PHE n 
3 55 LEU n 
3 56 GLN n 
3 57 HIS n 
3 58 SER n 
3 59 ASN n 
3 60 GLN n 
3 61 LYS n 
3 62 LEU n 
3 63 LYS n 
3 64 GLN n 
3 65 GLU n 
3 66 ASN n 
3 67 LEU n 
3 68 SER n 
3 69 LEU n 
3 70 ARG n 
3 71 THR n 
3 72 ALA n 
3 73 VAL n 
3 74 HIS n 
3 75 LYS n 
3 76 SER n 
3 77 LYS n 
3 78 SER n 
3 79 LEU n 
3 80 LYS n 
3 81 ASP n 
3 82 LEU n 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               human 
_entity_src_gen.gene_src_genus                     Homo 
_entity_src_gen.pdbx_gene_src_gene                 ? 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Homo sapiens' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     9606 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     Escherichia 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               ? 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          ? 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       ? 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
1 UNP SRBP1_HUMAN 3 ? ? P36956 ? 
2 PDB 1AM9        1 ? ? 1AM9   ? 
3 PDB 1AM9        2 ? ? 1AM9   ? 
1 1 1AM9 A 1 ? 82 ? P36956 319 ? 400 ? 319 400 
2 1 1AM9 B 1 ? 82 ? P36956 319 ? 400 ? 319 400 
3 1 1AM9 C 1 ? 82 ? P36956 319 ? 400 ? 319 400 
4 1 1AM9 D 1 ? 82 ? P36956 319 ? 400 ? 319 400 
5 2 1AM9 E 1 ? 17 ? 1AM9   1   ? 17  ? 1   17  
6 3 1AM9 F 1 ? 21 ? 1AM9   18  ? 38  ? 18  38  
7 2 1AM9 G 1 ? 17 ? 1AM9   39  ? 55  ? 39  55  
8 3 1AM9 H 1 ? 21 ? 1AM9   56  ? 76  ? 56  76  
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MG  non-polymer         . 'MAGNESIUM ION'                      ? 'Mg 2'            24.305  
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          1AM9 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      4.30 
_exptl_crystal.density_percent_sol   74.21 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            ? 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              5.6 
_exptl_crystal_grow.pdbx_pH_range   ? 
1 1  1 WATER      ? ? ? 
1 2  1 KCL        ? ? ? 
1 3  1 MGCL2      ? ? ? 
1 4  1 TRIS-HCL   ? ? ? 
1 5  2 WATER      ? ? ? 
1 6  2 MPD        ? ? ? 
1 7  2 KCL        ? ? ? 
1 8  2 MGCL2      ? ? ? 
1 9  2 MES        ? ? ? 
1 10 3 WATER      ? ? ? 
1 11 3 KCL        ? ? ? 
1 12 3 MGCL2      ? ? ? 
1 13 3 MES        ? ? ? 
1 14 3 'PEG 4000' ? ? ? 
1 15 3 MPD        ? ? ? 
#                     1 
_diffrn.ambient_temp           100.00 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   ? 
_diffrn_detector.pdbx_collection_date   1996-10-24 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             ? 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   . 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'CHESS BEAMLINE F1' 
_diffrn_source.pdbx_synchrotron_site       CHESS 
_diffrn_source.pdbx_synchrotron_beamline   F1 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        ? 
_reflns.entry_id                     1AM9 
_reflns.observed_criterion_sigma_I   0.000 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             20.000 
_reflns.d_resolution_high            2.300 
_reflns.number_obs                   48155 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         87.000 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              0.0710000 
_reflns.pdbx_netI_over_sigmaI        36.0 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              12.00 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             2.300 
_reflns_shell.d_res_low              2.480 
_reflns_shell.percent_possible_all   52.40 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        0.3400000 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_redundancy        4.000 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 1AM9 
_refine.ls_number_reflns_obs                     43209 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          2.000 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             6.000 
_refine.ls_d_res_high                            2.300 
_refine.ls_percent_reflns_obs                    85.000 
_refine.ls_R_factor_obs                          0.2190000 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2190000 
_refine.ls_R_factor_R_free                       0.2780000 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 10.000 
_refine.ls_number_reflns_R_free                  4306 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      'MAX-DNA STRUCTURE' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        2441 
_refine_hist.pdbx_number_atoms_nucleic_acid   1546 
_refine_hist.pdbx_number_atoms_ligand         14 
_refine_hist.number_atoms_solvent             287 
_refine_hist.number_atoms_total               4288 
_refine_hist.d_res_high                       2.300 
_refine_hist.d_res_low                        6.000 
x_bond_d                0.013 ? ? ? 'X-RAY DIFFRACTION' ? 
x_bond_d_na             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_bond_d_prot           ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d               ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d_na            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d_prot          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg             1.68  ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg_na          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg_prot        ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d      23.8  ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d      1.36  ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_mcbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_mcangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_scbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_scangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
_struct.entry_id                  1AM9 
_struct.title                     'HUMAN SREBP-1A BOUND TO LDL RECEPTOR PROMOTER' 
_struct.pdbx_descriptor           'STEROL REGULATORY ELEMENT BINDING(STRE)/DNA COMPLEX' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1AM9 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
A N N 1 ? 
B N N 2 ? 
C N N 1 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
G N N 3 ? 
H N N 3 ? 
I N N 4 ? 
J N N 4 ? 
K N N 5 ? 
L N N 5 ? 
M N N 5 ? 
N N N 5 ? 
O N N 5 ? 
P N N 5 ? 
Q N N 5 ? 
R N N 5 ? 
#   1 
HELX_P HELX_P1 1 ARG E 3  ? VAL E 32 ? ARG A 321 VAL A 350 1 ? 30 
HELX_P HELX_P2 2 LYS E 41 ? SER E 78 ? LYS A 359 SER A 396 1 ? 38 
HELX_P HELX_P3 3 ARG F 3  ? VAL F 32 ? ARG B 321 VAL B 350 1 ? 30 
HELX_P HELX_P4 4 LYS F 41 ? HIS F 74 ? LYS B 359 HIS B 392 1 ? 34 
HELX_P HELX_P5 5 ARG G 3  ? VAL G 33 ? ARG C 321 VAL C 351 1 ? 31 
HELX_P HELX_P6 6 LYS G 41 ? LYS G 77 ? LYS C 359 LYS C 395 1 ? 37 
HELX_P HELX_P7 7 ARG H 3  ? VAL H 32 ? ARG D 321 VAL D 350 1 ? 30 
HELX_P HELX_P8 8 LYS H 41 ? HIS H 74 ? LYS D 359 HIS D 392 1 ? 34 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? O HOH .  O  ? ? ? 1_555 I MG  .  MG ? ? A HOH 2009 B MG  2002 1_555 ? ? ? ? ? ? ?            2.057 ? ? 
metalc2  metalc ? ? O HOH .  O  ? ? ? 1_555 I MG  .  MG ? ? A HOH 2012 B MG  2002 1_555 ? ? ? ? ? ? ?            1.980 ? ? 
metalc3  metalc ? ? O HOH .  O  ? ? ? 1_555 I MG  .  MG ? ? A HOH 2013 B MG  2002 1_555 ? ? ? ? ? ? ?            2.128 ? ? 
metalc4  metalc ? ? I MG  .  MG ? ? ? 1_555 P HOH .  O  ? ? B MG  2002 B HOH 2010 1_555 ? ? ? ? ? ? ?            1.930 ? ? 
metalc5  metalc ? ? I MG  .  MG ? ? ? 1_555 P HOH .  O  ? ? B MG  2002 B HOH 2011 1_555 ? ? ? ? ? ? ?            2.029 ? ? 
metalc6  metalc ? ? I MG  .  MG ? ? ? 1_555 P HOH .  O  ? ? B MG  2002 B HOH 2014 1_555 ? ? ? ? ? ? ?            1.926 ? ? 
metalc7  metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2003 1_555 ? ? ? ? ? ? ?            2.057 ? ? 
metalc8  metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2004 1_555 ? ? ? ? ? ? ?            1.930 ? ? 
metalc9  metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2005 1_555 ? ? ? ? ? ? ?            2.029 ? ? 
metalc10 metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2006 1_555 ? ? ? ? ? ? ?            1.980 ? ? 
metalc11 metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2007 1_555 ? ? ? ? ? ? ?            2.128 ? ? 
metalc12 metalc ? ? J MG  .  MG ? ? ? 1_555 R HOH .  O  ? ? C MG  2001 D HOH 2008 1_555 ? ? ? ? ? ? ?            1.926 ? ? 
hydrog1  hydrog ? ? A DT  1  N3 ? ? ? 1_555 D DA  21 N1 ? ? E DT  1    H DA  76   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog2  hydrog ? ? A DT  1  O4 ? ? ? 1_555 D DA  21 N6 ? ? E DT  1    H DA  76   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog3  hydrog ? ? A DT  2  N3 ? ? ? 1_555 D DA  20 N1 ? ? E DT  2    H DA  75   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog4  hydrog ? ? A DT  2  O4 ? ? ? 1_555 D DA  20 N6 ? ? E DT  2    H DA  75   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog5  hydrog ? ? A DG  3  N1 ? ? ? 1_555 D DC  19 N3 ? ? E DG  3    H DC  74   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog6  hydrog ? ? A DG  3  N2 ? ? ? 1_555 D DC  19 O2 ? ? E DG  3    H DC  74   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog7  hydrog ? ? A DG  3  O6 ? ? ? 1_555 D DC  19 N4 ? ? E DG  3    H DC  74   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog8  hydrog ? ? A DC  4  N3 ? ? ? 1_555 D DG  18 N1 ? ? E DC  4    H DG  73   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog9  hydrog ? ? A DC  4  N4 ? ? ? 1_555 D DG  18 O6 ? ? E DC  4    H DG  73   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog10 hydrog ? ? A DC  4  O2 ? ? ? 1_555 D DG  18 N2 ? ? E DC  4    H DG  73   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog11 hydrog ? ? A DA  5  N1 ? ? ? 1_555 D DT  17 N3 ? ? E DA  5    H DT  72   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog12 hydrog ? ? A DA  5  N6 ? ? ? 1_555 D DT  17 O4 ? ? E DA  5    H DT  72   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog13 hydrog ? ? A DG  6  N1 ? ? ? 1_555 D DC  16 N3 ? ? E DG  6    H DC  71   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog14 hydrog ? ? A DG  6  N2 ? ? ? 1_555 D DC  16 O2 ? ? E DG  6    H DC  71   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog15 hydrog ? ? A DG  6  O6 ? ? ? 1_555 D DC  16 N4 ? ? E DG  6    H DC  71   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog16 hydrog ? ? A DT  7  N3 ? ? ? 1_555 D DA  15 N1 ? ? E DT  7    H DA  70   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog17 hydrog ? ? A DT  7  O4 ? ? ? 1_555 D DA  15 N6 ? ? E DT  7    H DA  70   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog18 hydrog ? ? A DG  8  N1 ? ? ? 1_555 D DC  14 N3 ? ? E DG  8    H DC  69   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog19 hydrog ? ? A DG  8  N2 ? ? ? 1_555 D DC  14 O2 ? ? E DG  8    H DC  69   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog20 hydrog ? ? A DG  8  O6 ? ? ? 1_555 D DC  14 N4 ? ? E DG  8    H DC  69   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog21 hydrog ? ? A DG  9  N1 ? ? ? 1_555 D DC  13 N3 ? ? E DG  9    H DC  68   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog22 hydrog ? ? A DG  9  N2 ? ? ? 1_555 D DC  13 O2 ? ? E DG  9    H DC  68   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog23 hydrog ? ? A DG  9  O6 ? ? ? 1_555 D DC  13 N4 ? ? E DG  9    H DC  68   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog24 hydrog ? ? A DG  10 N1 ? ? ? 1_555 D DC  12 N3 ? ? E DG  10   H DC  67   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog25 hydrog ? ? A DG  10 N2 ? ? ? 1_555 D DC  12 O2 ? ? E DG  10   H DC  67   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog26 hydrog ? ? A DG  10 O6 ? ? ? 1_555 D DC  12 N4 ? ? E DG  10   H DC  67   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog27 hydrog ? ? A DG  11 N1 ? ? ? 1_555 D DC  11 N3 ? ? E DG  11   H DC  66   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog28 hydrog ? ? A DG  11 N2 ? ? ? 1_555 D DC  11 O2 ? ? E DG  11   H DC  66   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog29 hydrog ? ? A DG  11 O6 ? ? ? 1_555 D DC  11 N4 ? ? E DG  11   H DC  66   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog30 hydrog ? ? A DT  12 N3 ? ? ? 1_555 D DA  10 N1 ? ? E DT  12   H DA  65   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog31 hydrog ? ? A DT  12 O4 ? ? ? 1_555 D DA  10 N6 ? ? E DT  12   H DA  65   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog32 hydrog ? ? A DG  13 N1 ? ? ? 1_555 D DC  9  N3 ? ? E DG  13   H DC  64   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog33 hydrog ? ? A DG  13 N2 ? ? ? 1_555 D DC  9  O2 ? ? E DG  13   H DC  64   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog34 hydrog ? ? A DG  13 O6 ? ? ? 1_555 D DC  9  N4 ? ? E DG  13   H DC  64   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog35 hydrog ? ? A DA  14 N1 ? ? ? 1_555 D DT  8  N3 ? ? E DA  14   H DT  63   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog36 hydrog ? ? A DA  14 N6 ? ? ? 1_555 D DT  8  O4 ? ? E DA  14   H DT  63   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog37 hydrog ? ? A DT  15 N3 ? ? ? 1_555 D DA  7  N1 ? ? E DT  15   H DA  62   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog38 hydrog ? ? A DT  15 O4 ? ? ? 1_555 D DA  7  N6 ? ? E DT  15   H DA  62   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog39 hydrog ? ? A DC  16 N3 ? ? ? 1_555 D DG  6  N1 ? ? E DC  16   H DG  61   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog40 hydrog ? ? A DC  16 N4 ? ? ? 1_555 D DG  6  O6 ? ? E DC  16   H DG  61   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog41 hydrog ? ? A DC  16 O2 ? ? ? 1_555 D DG  6  N2 ? ? E DC  16   H DG  61   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog42 hydrog ? ? A DT  17 N3 ? ? ? 1_555 D DA  5  N1 ? ? E DT  17   H DA  60   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog43 hydrog ? ? A DT  17 O4 ? ? ? 1_555 D DA  5  N6 ? ? E DT  17   H DA  60   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog44 hydrog ? ? B DC  1  N3 ? ? ? 1_555 D DG  4  N1 ? ? F DC  18   H DG  59   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog45 hydrog ? ? B DC  1  N4 ? ? ? 1_555 D DG  4  O6 ? ? F DC  18   H DG  59   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog46 hydrog ? ? B DC  1  O2 ? ? ? 1_555 D DG  4  N2 ? ? F DC  18   H DG  59   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog47 hydrog ? ? B DA  2  N1 ? ? ? 1_555 D DT  3  N3 ? ? F DA  19   H DT  58   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog48 hydrog ? ? B DA  2  N6 ? ? ? 1_555 D DT  3  O4 ? ? F DA  19   H DT  58   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog49 hydrog ? ? B DT  3  N3 ? ? ? 1_555 D DA  2  N1 ? ? F DT  20   H DA  57   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog50 hydrog ? ? B DT  3  O4 ? ? ? 1_555 D DA  2  N6 ? ? F DT  20   H DA  57   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog51 hydrog ? ? B DG  4  N1 ? ? ? 1_555 D DC  1  N3 ? ? F DG  21   H DC  56   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog52 hydrog ? ? B DG  4  N2 ? ? ? 1_555 D DC  1  O2 ? ? F DG  21   H DC  56   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog53 hydrog ? ? B DG  4  O6 ? ? ? 1_555 D DC  1  N4 ? ? F DG  21   H DC  56   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog54 hydrog ? ? B DA  5  N1 ? ? ? 1_555 C DT  17 N3 ? ? F DA  22   G DT  55   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog55 hydrog ? ? B DA  5  N6 ? ? ? 1_555 C DT  17 O4 ? ? F DA  22   G DT  55   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog56 hydrog ? ? B DG  6  N1 ? ? ? 1_555 C DC  16 N3 ? ? F DG  23   G DC  54   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog57 hydrog ? ? B DG  6  N2 ? ? ? 1_555 C DC  16 O2 ? ? F DG  23   G DC  54   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog58 hydrog ? ? B DG  6  O6 ? ? ? 1_555 C DC  16 N4 ? ? F DG  23   G DC  54   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog59 hydrog ? ? B DA  7  N1 ? ? ? 1_555 C DT  15 N3 ? ? F DA  24   G DT  53   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog60 hydrog ? ? B DA  7  N6 ? ? ? 1_555 C DT  15 O4 ? ? F DA  24   G DT  53   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog61 hydrog ? ? B DT  8  N3 ? ? ? 1_555 C DA  14 N1 ? ? F DT  25   G DA  52   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog62 hydrog ? ? B DT  8  O4 ? ? ? 1_555 C DA  14 N6 ? ? F DT  25   G DA  52   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog63 hydrog ? ? B DC  9  N3 ? ? ? 1_555 C DG  13 N1 ? ? F DC  26   G DG  51   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog64 hydrog ? ? B DC  9  N4 ? ? ? 1_555 C DG  13 O6 ? ? F DC  26   G DG  51   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog65 hydrog ? ? B DC  9  O2 ? ? ? 1_555 C DG  13 N2 ? ? F DC  26   G DG  51   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog66 hydrog ? ? B DA  10 N1 ? ? ? 1_555 C DT  12 N3 ? ? F DA  27   G DT  50   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog67 hydrog ? ? B DA  10 N6 ? ? ? 1_555 C DT  12 O4 ? ? F DA  27   G DT  50   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog68 hydrog ? ? B DC  11 N3 ? ? ? 1_555 C DG  11 N1 ? ? F DC  28   G DG  49   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog69 hydrog ? ? B DC  11 N4 ? ? ? 1_555 C DG  11 O6 ? ? F DC  28   G DG  49   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog70 hydrog ? ? B DC  11 O2 ? ? ? 1_555 C DG  11 N2 ? ? F DC  28   G DG  49   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog71 hydrog ? ? B DC  12 N3 ? ? ? 1_555 C DG  10 N1 ? ? F DC  29   G DG  48   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog72 hydrog ? ? B DC  12 N4 ? ? ? 1_555 C DG  10 O6 ? ? F DC  29   G DG  48   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog73 hydrog ? ? B DC  12 O2 ? ? ? 1_555 C DG  10 N2 ? ? F DC  29   G DG  48   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog74 hydrog ? ? B DC  13 N3 ? ? ? 1_555 C DG  9  N1 ? ? F DC  30   G DG  47   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog75 hydrog ? ? B DC  13 N4 ? ? ? 1_555 C DG  9  O6 ? ? F DC  30   G DG  47   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog76 hydrog ? ? B DC  13 O2 ? ? ? 1_555 C DG  9  N2 ? ? F DC  30   G DG  47   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog77 hydrog ? ? B DC  14 N3 ? ? ? 1_555 C DG  8  N1 ? ? F DC  31   G DG  46   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog78 hydrog ? ? B DC  14 N4 ? ? ? 1_555 C DG  8  O6 ? ? F DC  31   G DG  46   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog79 hydrog ? ? B DC  14 O2 ? ? ? 1_555 C DG  8  N2 ? ? F DC  31   G DG  46   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog80 hydrog ? ? B DA  15 N1 ? ? ? 1_555 C DT  7  N3 ? ? F DA  32   G DT  45   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog81 hydrog ? ? B DA  15 N6 ? ? ? 1_555 C DT  7  O4 ? ? F DA  32   G DT  45   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog82 hydrog ? ? B DC  16 N3 ? ? ? 1_555 C DG  6  N1 ? ? F DC  33   G DG  44   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog83 hydrog ? ? B DC  16 N4 ? ? ? 1_555 C DG  6  O6 ? ? F DC  33   G DG  44   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog84 hydrog ? ? B DC  16 O2 ? ? ? 1_555 C DG  6  N2 ? ? F DC  33   G DG  44   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog85 hydrog ? ? B DT  17 N3 ? ? ? 1_555 C DA  5  N1 ? ? F DT  34   G DA  43   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog86 hydrog ? ? B DT  17 O4 ? ? ? 1_555 C DA  5  N6 ? ? F DT  34   G DA  43   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog87 hydrog ? ? B DG  18 N1 ? ? ? 1_555 C DC  4  N3 ? ? F DG  35   G DC  42   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog88 hydrog ? ? B DG  18 N2 ? ? ? 1_555 C DC  4  O2 ? ? F DG  35   G DC  42   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog89 hydrog ? ? B DG  18 O6 ? ? ? 1_555 C DC  4  N4 ? ? F DG  35   G DC  42   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog90 hydrog ? ? B DC  19 N3 ? ? ? 1_555 C DG  3  N1 ? ? F DC  36   G DG  41   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog91 hydrog ? ? B DC  19 N4 ? ? ? 1_555 C DG  3  O6 ? ? F DC  36   G DG  41   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog92 hydrog ? ? B DC  19 O2 ? ? ? 1_555 C DG  3  N2 ? ? F DC  36   G DG  41   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog93 hydrog ? ? B DA  20 N1 ? ? ? 1_555 C DT  2  N3 ? ? F DA  37   G DT  40   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog94 hydrog ? ? B DA  20 N6 ? ? ? 1_555 C DT  2  O4 ? ? F DA  37   G DT  40   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog95 hydrog ? ? B DA  21 N1 ? ? ? 1_555 C DT  1  N3 ? ? F DA  38   G DT  39   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog96 hydrog ? ? B DA  21 N6 ? ? ? 1_555 C DT  1  O4 ? ? F DA  38   G DT  39   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
metalc ? ? 
hydrog ? ? 
AC1 Software C MG 2001 ? 6 'BINDING SITE FOR RESIDUE MG C 2001' 
AC2 Software B MG 2002 ? 6 'BINDING SITE FOR RESIDUE MG B 2002' 
1  AC1 6 HOH R . ? HOH D 2003 . ? 1_555 ? 
2  AC1 6 HOH R . ? HOH D 2004 . ? 1_555 ? 
3  AC1 6 HOH R . ? HOH D 2005 . ? 1_555 ? 
4  AC1 6 HOH R . ? HOH D 2006 . ? 1_555 ? 
5  AC1 6 HOH R . ? HOH D 2007 . ? 1_555 ? 
6  AC1 6 HOH R . ? HOH D 2008 . ? 1_555 ? 
7  AC2 6 HOH O . ? HOH A 2009 . ? 1_555 ? 
8  AC2 6 HOH O . ? HOH A 2012 . ? 1_555 ? 
9  AC2 6 HOH O . ? HOH A 2013 . ? 1_555 ? 
10 AC2 6 HOH P . ? HOH B 2010 . ? 1_555 ? 
11 AC2 6 HOH P . ? HOH B 2011 . ? 1_555 ? 
12 AC2 6 HOH P . ? HOH B 2014 . ? 1_555 ? 
_database_PDB_matrix.entry_id          1AM9 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1AM9 
_atom_sites.fract_transf_matrix[1][1]   0.010567 
_atom_sites.fract_transf_matrix[1][2]   0.006101 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.012202 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.002178 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O  "O5'" . DT  A 1 1  ? 34.431  51.567  213.108 1.00 41.75 ? 1    DT  E "O5'" 1 
ATOM   2    C  "C5'" . DT  A 1 1  ? 35.350  51.621  212.024 1.00 33.79 ? 1    DT  E "C5'" 1 
ATOM   3    C  "C4'" . DT  A 1 1  ? 35.800  50.239  211.647 1.00 34.99 ? 1    DT  E "C4'" 1 
ATOM   4    O  "O4'" . DT  A 1 1  ? 34.785  49.580  210.894 1.00 37.97 ? 1    DT  E "O4'" 1 
ATOM   5    C  "C3'" . DT  A 1 1  ? 37.008  50.303  210.748 1.00 42.42 ? 1    DT  E "C3'" 1 
ATOM   6    O  "O3'" . DT  A 1 1  ? 37.810  49.134  210.942 1.00 52.29 ? 1    DT  E "O3'" 1 
ATOM   7    C  "C2'" . DT  A 1 1  ? 36.369  50.324  209.358 1.00 36.69 ? 1    DT  E "C2'" 1 
ATOM   8    C  "C1'" . DT  A 1 1  ? 35.193  49.386  209.540 1.00 30.79 ? 1    DT  E "C1'" 1 
ATOM   9    N  N1    . DT  A 1 1  ? 34.048  49.750  208.693 1.00 27.99 ? 1    DT  E N1    1 
ATOM   10   C  C2    . DT  A 1 1  ? 33.312  48.705  208.187 1.00 25.17 ? 1    DT  E C2    1 
ATOM   11   O  O2    . DT  A 1 1  ? 33.718  47.550  208.230 1.00 25.24 ? 1    DT  E O2    1 
ATOM   12   N  N3    . DT  A 1 1  ? 32.103  49.039  207.604 1.00 26.66 ? 1    DT  E N3    1 
ATOM   13   C  C4    . DT  A 1 1  ? 31.590  50.315  207.488 1.00 25.54 ? 1    DT  E C4    1 
ATOM   14   O  O4    . DT  A 1 1  ? 30.435  50.473  207.104 1.00 26.66 ? 1    DT  E O4    1 
ATOM   15   C  C5    . DT  A 1 1  ? 32.443  51.354  208.017 1.00 23.37 ? 1    DT  E C5    1 
ATOM   16   C  C7    . DT  A 1 1  ? 31.954  52.805  208.011 1.00 25.73 ? 1    DT  E C7    1 
ATOM   17   C  C6    . DT  A 1 1  ? 33.620  51.049  208.587 1.00 26.35 ? 1    DT  E C6    1 
ATOM   18   P  P     . DT  A 1 2  ? 39.366  49.181  210.552 1.00 53.63 ? 2    DT  E P     1 
ATOM   19   O  OP1   . DT  A 1 2  ? 40.160  48.601  211.658 1.00 61.15 ? 2    DT  E OP1   1 
ATOM   20   O  OP2   . DT  A 1 2  ? 39.672  50.544  210.051 1.00 51.08 ? 2    DT  E OP2   1 
ATOM   21   O  "O5'" . DT  A 1 2  ? 39.342  48.131  209.337 1.00 51.67 ? 2    DT  E "O5'" 1 
ATOM   22   C  "C5'" . DT  A 1 2  ? 38.638  46.899  209.464 1.00 47.89 ? 2    DT  E "C5'" 1 
ATOM   23   C  "C4'" . DT  A 1 2  ? 38.604  46.113  208.149 1.00 57.57 ? 2    DT  E "C4'" 1 
ATOM   24   O  "O4'" . DT  A 1 2  ? 37.422  46.368  207.383 1.00 57.42 ? 2    DT  E "O4'" 1 
ATOM   25   C  "C3'" . DT  A 1 2  ? 39.757  46.463  207.187 1.00 60.34 ? 2    DT  E "C3'" 1 
ATOM   26   O  "O3'" . DT  A 1 2  ? 39.996  45.330  206.346 1.00 60.54 ? 2    DT  E "O3'" 1 
ATOM   27   C  "C2'" . DT  A 1 2  ? 39.132  47.561  206.335 1.00 49.78 ? 2    DT  E "C2'" 1 
ATOM   28   C  "C1'" . DT  A 1 2  ? 37.772  46.923  206.102 1.00 45.57 ? 2    DT  E "C1'" 1 
ATOM   29   N  N1    . DT  A 1 2  ? 36.777  47.911  205.679 1.00 37.85 ? 2    DT  E N1    1 
ATOM   30   C  C2    . DT  A 1 2  ? 35.568  47.440  205.174 1.00 38.47 ? 2    DT  E C2    1 
ATOM   31   O  O2    . DT  A 1 2  ? 35.308  46.242  205.037 1.00 37.13 ? 2    DT  E O2    1 
ATOM   32   N  N3    . DT  A 1 2  ? 34.620  48.405  204.907 1.00 37.30 ? 2    DT  E N3    1 
ATOM   33   C  C4    . DT  A 1 2  ? 34.773  49.760  205.107 1.00 38.17 ? 2    DT  E C4    1 
ATOM   34   O  O4    . DT  A 1 2  ? 33.835  50.525  204.895 1.00 40.29 ? 2    DT  E O4    1 
ATOM   35   C  C5    . DT  A 1 2  ? 36.064  50.145  205.624 1.00 37.02 ? 2    DT  E C5    1 
ATOM   36   C  C7    . DT  A 1 2  ? 36.360  51.615  205.875 1.00 35.59 ? 2    DT  E C7    1 
ATOM   37   C  C6    . DT  A 1 2  ? 37.004  49.234  205.886 1.00 35.87 ? 2    DT  E C6    1 
ATOM   38   P  P     . DG  A 1 3  ? 41.279  44.410  206.587 1.00 55.20 ? 3    DG  E P     1 
ATOM   39   O  OP1   . DG  A 1 3  ? 41.338  44.039  208.020 1.00 69.20 ? 3    DG  E OP1   1 
ATOM   40   O  OP2   . DG  A 1 3  ? 42.430  45.099  205.957 1.00 58.66 ? 3    DG  E OP2   1 
ATOM   41   O  "O5'" . DG  A 1 3  ? 40.869  43.095  205.770 1.00 48.28 ? 3    DG  E "O5'" 1 
ATOM   42   C  "C5'" . DG  A 1 3  ? 39.707  42.405  206.211 1.00 47.39 ? 3    DG  E "C5'" 1 
ATOM   43   C  "C4'" . DG  A 1 3  ? 38.846  41.909  205.059 1.00 55.75 ? 3    DG  E "C4'" 1 
ATOM   44   O  "O4'" . DG  A 1 3  ? 38.195  42.998  204.393 1.00 57.27 ? 3    DG  E "O4'" 1 
ATOM   45   C  "C3'" . DG  A 1 3  ? 39.693  41.234  203.975 1.00 62.54 ? 3    DG  E "C3'" 1 
ATOM   46   O  "O3'" . DG  A 1 3  ? 38.866  40.380  203.160 1.00 69.76 ? 3    DG  E "O3'" 1 
ATOM   47   C  "C2'" . DG  A 1 3  ? 40.111  42.447  203.147 1.00 54.28 ? 3    DG  E "C2'" 1 
ATOM   48   C  "C1'" . DG  A 1 3  ? 38.765  43.173  203.083 1.00 49.64 ? 3    DG  E "C1'" 1 
ATOM   49   N  N9    . DG  A 1 3  ? 38.901  44.610  202.826 1.00 36.71 ? 3    DG  E N9    1 
ATOM   50   C  C8    . DG  A 1 3  ? 39.895  45.474  203.210 1.00 36.25 ? 3    DG  E C8    1 
ATOM   51   N  N7    . DG  A 1 3  ? 39.560  46.733  203.126 1.00 36.09 ? 3    DG  E N7    1 
ATOM   52   C  C5    . DG  A 1 3  ? 38.252  46.694  202.639 1.00 34.32 ? 3    DG  E C5    1 
ATOM   53   C  C6    . DG  A 1 3  ? 37.332  47.754  202.403 1.00 34.15 ? 3    DG  E C6    1 
ATOM   54   O  O6    . DG  A 1 3  ? 37.485  48.951  202.656 1.00 34.81 ? 3    DG  E O6    1 
ATOM   55   N  N1    . DG  A 1 3  ? 36.111  47.277  201.949 1.00 31.47 ? 3    DG  E N1    1 
ATOM   56   C  C2    . DG  A 1 3  ? 35.816  45.941  201.758 1.00 33.44 ? 3    DG  E C2    1 
ATOM   57   N  N2    . DG  A 1 3  ? 34.609  45.638  201.295 1.00 31.69 ? 3    DG  E N2    1 
ATOM   58   N  N3    . DG  A 1 3  ? 36.673  44.942  201.995 1.00 34.07 ? 3    DG  E N3    1 
ATOM   59   C  C4    . DG  A 1 3  ? 37.862  45.399  202.435 1.00 33.99 ? 3    DG  E C4    1 
ATOM   60   P  P     . DC  A 1 4  ? 39.570  39.456  202.033 1.00 65.12 ? 4    DC  E P     1 
ATOM   61   O  OP1   . DC  A 1 4  ? 40.667  38.693  202.675 1.00 74.42 ? 4    DC  E OP1   1 
ATOM   62   O  OP2   . DC  A 1 4  ? 39.868  40.305  200.855 1.00 69.18 ? 4    DC  E OP2   1 
ATOM   63   O  "O5'" . DC  A 1 4  ? 38.414  38.421  201.623 1.00 66.74 ? 4    DC  E "O5'" 1 
ATOM   64   C  "C5'" . DC  A 1 4  ? 38.214  38.295  200.225 1.00 63.09 ? 4    DC  E "C5'" 1 
ATOM   65   C  "C4'" . DC  A 1 4  ? 37.163  39.267  199.636 1.00 54.05 ? 4    DC  E "C4'" 1 
ATOM   66   O  "O4'" . DC  A 1 4  ? 37.253  40.662  200.013 1.00 46.65 ? 4    DC  E "O4'" 1 
ATOM   67   C  "C3'" . DC  A 1 4  ? 37.372  39.257  198.134 1.00 47.86 ? 4    DC  E "C3'" 1 
ATOM   68   O  "O3'" . DC  A 1 4  ? 36.133  39.220  197.477 1.00 56.51 ? 4    DC  E "O3'" 1 
ATOM   69   C  "C2'" . DC  A 1 4  ? 38.001  40.594  197.834 1.00 34.89 ? 4    DC  E "C2'" 1 
ATOM   70   C  "C1'" . DC  A 1 4  ? 37.253  41.454  198.819 1.00 33.37 ? 4    DC  E "C1'" 1 
ATOM   71   N  N1    . DC  A 1 4  ? 37.912  42.763  198.992 1.00 29.70 ? 4    DC  E N1    1 
ATOM   72   C  C2    . DC  A 1 4  ? 37.168  43.905  198.743 1.00 29.98 ? 4    DC  E C2    1 
ATOM   73   O  O2    . DC  A 1 4  ? 36.032  43.793  198.267 1.00 31.34 ? 4    DC  E O2    1 
ATOM   74   N  N3    . DC  A 1 4  ? 37.766  45.119  198.924 1.00 26.41 ? 4    DC  E N3    1 
ATOM   75   C  C4    . DC  A 1 4  ? 39.041  45.185  199.321 1.00 26.64 ? 4    DC  E C4    1 
ATOM   76   N  N4    . DC  A 1 4  ? 39.627  46.358  199.575 1.00 27.20 ? 4    DC  E N4    1 
ATOM   77   C  C5    . DC  A 1 4  ? 39.809  44.015  199.547 1.00 25.54 ? 4    DC  E C5    1 
ATOM   78   C  C6    . DC  A 1 4  ? 39.199  42.832  199.372 1.00 25.93 ? 4    DC  E C6    1 
ATOM   79   P  P     . DA  A 1 5  ? 36.246  38.556  196.038 1.00 54.20 ? 5    DA  E P     1 
ATOM   80   O  OP1   . DA  A 1 5  ? 35.527  37.255  196.030 1.00 61.14 ? 5    DA  E OP1   1 
ATOM   81   O  OP2   . DA  A 1 5  ? 37.666  38.647  195.615 1.00 62.76 ? 5    DA  E OP2   1 
ATOM   82   O  "O5'" . DA  A 1 5  ? 35.391  39.576  195.184 1.00 57.48 ? 5    DA  E "O5'" 1 
ATOM   83   C  "C5'" . DA  A 1 5  ? 33.983  39.446  195.278 1.00 48.41 ? 5    DA  E "C5'" 1 
ATOM   84   C  "C4'" . DA  A 1 5  ? 33.368  40.613  194.586 1.00 42.10 ? 5    DA  E "C4'" 1 
ATOM   85   O  "O4'" . DA  A 1 5  ? 34.078  41.788  194.991 1.00 37.91 ? 5    DA  E "O4'" 1 
ATOM   86   C  "C3'" . DA  A 1 5  ? 33.567  40.472  193.094 1.00 40.08 ? 5    DA  E "C3'" 1 
ATOM   87   O  "O3'" . DA  A 1 5  ? 32.396  41.006  192.488 1.00 43.70 ? 5    DA  E "O3'" 1 
ATOM   88   C  "C2'" . DA  A 1 5  ? 34.845  41.289  192.843 1.00 32.62 ? 5    DA  E "C2'" 1 
ATOM   89   C  "C1'" . DA  A 1 5  ? 34.783  42.365  193.911 1.00 29.42 ? 5    DA  E "C1'" 1 
ATOM   90   N  N9    . DA  A 1 5  ? 36.102  42.722  194.427 1.00 24.43 ? 5    DA  E N9    1 
ATOM   91   C  C8    . DA  A 1 5  ? 37.201  41.922  194.617 1.00 23.10 ? 5    DA  E C8    1 
ATOM   92   N  N7    . DA  A 1 5  ? 38.251  42.560  195.077 1.00 22.26 ? 5    DA  E N7    1 
ATOM   93   C  C5    . DA  A 1 5  ? 37.805  43.871  195.203 1.00 19.32 ? 5    DA  E C5    1 
ATOM   94   C  C6    . DA  A 1 5  ? 38.433  45.035  195.642 1.00 21.89 ? 5    DA  E C6    1 
ATOM   95   N  N6    . DA  A 1 5  ? 39.701  45.039  196.033 1.00 21.78 ? 5    DA  E N6    1 
ATOM   96   N  N1    . DA  A 1 5  ? 37.723  46.167  195.663 1.00 20.61 ? 5    DA  E N1    1 
ATOM   97   C  C2    . DA  A 1 5  ? 36.461  46.123  195.261 1.00 21.56 ? 5    DA  E C2    1 
ATOM   98   N  N3    . DA  A 1 5  ? 35.746  45.092  194.819 1.00 23.21 ? 5    DA  E N3    1 
ATOM   99   C  C4    . DA  A 1 5  ? 36.498  43.976  194.819 1.00 21.38 ? 5    DA  E C4    1 
ATOM   100  P  P     . DG  A 1 6  ? 32.286  41.352  190.930 1.00 51.09 ? 6    DG  E P     1 
ATOM   101  O  OP1   . DG  A 1 6  ? 30.863  41.598  190.605 1.00 55.06 ? 6    DG  E OP1   1 
ATOM   102  O  OP2   . DG  A 1 6  ? 33.078  40.391  190.120 1.00 49.40 ? 6    DG  E OP2   1 
ATOM   103  O  "O5'" . DG  A 1 6  ? 33.042  42.746  190.973 1.00 43.87 ? 6    DG  E "O5'" 1 
ATOM   104  C  "C5'" . DG  A 1 6  ? 32.389  43.774  191.669 1.00 33.06 ? 6    DG  E "C5'" 1 
ATOM   105  C  "C4'" . DG  A 1 6  ? 32.847  45.095  191.166 1.00 29.36 ? 6    DG  E "C4'" 1 
ATOM   106  O  "O4'" . DG  A 1 6  ? 34.097  45.438  191.750 1.00 34.26 ? 6    DG  E "O4'" 1 
ATOM   107  C  "C3'" . DG  A 1 6  ? 33.080  45.097  189.667 1.00 32.88 ? 6    DG  E "C3'" 1 
ATOM   108  O  "O3'" . DG  A 1 6  ? 32.815  46.437  189.286 1.00 33.77 ? 6    DG  E "O3'" 1 
ATOM   109  C  "C2'" . DG  A 1 6  ? 34.582  44.797  189.585 1.00 29.35 ? 6    DG  E "C2'" 1 
ATOM   110  C  "C1'" . DG  A 1 6  ? 35.097  45.622  190.750 1.00 26.07 ? 6    DG  E "C1'" 1 
ATOM   111  N  N9    . DG  A 1 6  ? 36.366  45.116  191.263 1.00 20.78 ? 6    DG  E N9    1 
ATOM   112  C  C8    . DG  A 1 6  ? 36.796  43.822  191.302 1.00 19.33 ? 6    DG  E C8    1 
ATOM   113  N  N7    . DG  A 1 6  ? 38.027  43.696  191.742 1.00 20.82 ? 6    DG  E N7    1 
ATOM   114  C  C5    . DG  A 1 6  ? 38.429  44.997  192.015 1.00 18.24 ? 6    DG  E C5    1 
ATOM   115  C  C6    . DG  A 1 6  ? 39.668  45.464  192.491 1.00 20.91 ? 6    DG  E C6    1 
ATOM   116  O  O6    . DG  A 1 6  ? 40.712  44.824  192.655 1.00 25.11 ? 6    DG  E O6    1 
ATOM   117  N  N1    . DG  A 1 6  ? 39.649  46.838  192.655 1.00 18.76 ? 6    DG  E N1    1 
ATOM   118  C  C2    . DG  A 1 6  ? 38.579  47.648  192.375 1.00 18.92 ? 6    DG  E C2    1 
ATOM   119  N  N2    . DG  A 1 6  ? 38.771  48.941  192.580 1.00 17.79 ? 6    DG  E N2    1 
ATOM   120  N  N3    . DG  A 1 6  ? 37.412  47.212  191.907 1.00 18.45 ? 6    DG  E N3    1 
ATOM   121  C  C4    . DG  A 1 6  ? 37.413  45.875  191.748 1.00 17.60 ? 6    DG  E C4    1 
ATOM   122  P  P     . DT  A 1 7  ? 32.572  46.903  187.790 1.00 33.00 ? 7    DT  E P     1 
ATOM   123  O  OP1   . DT  A 1 7  ? 31.450  47.868  187.785 1.00 32.90 ? 7    DT  E OP1   1 
ATOM   124  O  OP2   . DT  A 1 7  ? 32.571  45.707  186.917 1.00 35.34 ? 7    DT  E OP2   1 
ATOM   125  O  "O5'" . DT  A 1 7  ? 33.892  47.716  187.542 1.00 25.06 ? 7    DT  E "O5'" 1 
ATOM   126  C  "C5'" . DT  A 1 7  ? 34.023  48.822  188.388 1.00 22.89 ? 7    DT  E "C5'" 1 
ATOM   127  C  "C4'" . DT  A 1 7  ? 35.351  49.469  188.225 1.00 25.68 ? 7    DT  E "C4'" 1 
ATOM   128  O  "O4'" . DT  A 1 7  ? 36.344  48.716  188.921 1.00 24.96 ? 7    DT  E "O4'" 1 
ATOM   129  C  "C3'" . DT  A 1 7  ? 35.734  49.466  186.767 1.00 28.82 ? 7    DT  E "C3'" 1 
ATOM   130  O  "O3'" . DT  A 1 7  ? 36.032  50.793  186.345 1.00 31.79 ? 7    DT  E "O3'" 1 
ATOM   131  C  "C2'" . DT  A 1 7  ? 36.986  48.564  186.725 1.00 26.06 ? 7    DT  E "C2'" 1 
ATOM   132  C  "C1'" . DT  A 1 7  ? 37.509  48.621  188.142 1.00 19.91 ? 7    DT  E "C1'" 1 
ATOM   133  N  N1    . DT  A 1 7  ? 38.301  47.439  188.534 1.00 18.76 ? 7    DT  E N1    1 
ATOM   134  C  C2    . DT  A 1 7  ? 39.547  47.686  189.099 1.00 20.17 ? 7    DT  E C2    1 
ATOM   135  O  O2    . DT  A 1 7  ? 39.934  48.820  189.378 1.00 21.55 ? 7    DT  E O2    1 
ATOM   136  N  N3    . DT  A 1 7  ? 40.350  46.586  189.335 1.00 18.15 ? 7    DT  E N3    1 
ATOM   137  C  C4    . DT  A 1 7  ? 40.013  45.273  189.063 1.00 18.28 ? 7    DT  E C4    1 
ATOM   138  O  O4    . DT  A 1 7  ? 40.748  44.354  189.421 1.00 20.51 ? 7    DT  E O4    1 
ATOM   139  C  C5    . DT  A 1 7  ? 38.701  45.110  188.481 1.00 17.04 ? 7    DT  E C5    1 
ATOM   140  C  C7    . DT  A 1 7  ? 38.225  43.698  188.173 1.00 15.35 ? 7    DT  E C7    1 
ATOM   141  C  C6    . DT  A 1 7  ? 37.897  46.167  188.242 1.00 17.27 ? 7    DT  E C6    1 
ATOM   142  P  P     . DG  A 1 8  ? 36.138  51.107  184.778 1.00 29.57 ? 8    DG  E P     1 
ATOM   143  O  OP1   . DG  A 1 8  ? 35.594  52.457  184.491 1.00 22.77 ? 8    DG  E OP1   1 
ATOM   144  O  OP2   . DG  A 1 8  ? 35.710  49.914  184.009 1.00 28.09 ? 8    DG  E OP2   1 
ATOM   145  O  "O5'" . DG  A 1 8  ? 37.735  51.184  184.785 1.00 28.23 ? 8    DG  E "O5'" 1 
ATOM   146  C  "C5'" . DG  A 1 8  ? 38.283  52.277  185.515 1.00 24.12 ? 8    DG  E "C5'" 1 
ATOM   147  C  "C4'" . DG  A 1 8  ? 39.787  52.277  185.542 1.00 22.66 ? 8    DG  E "C4'" 1 
ATOM   148  O  "O4'" . DG  A 1 8  ? 40.249  51.150  186.260 1.00 27.95 ? 8    DG  E "O4'" 1 
ATOM   149  C  "C3'" . DG  A 1 8  ? 40.353  52.121  184.155 1.00 24.50 ? 8    DG  E "C3'" 1 
ATOM   150  O  "O3'" . DG  A 1 8  ? 41.588  52.788  184.116 1.00 33.95 ? 8    DG  E "O3'" 1 
ATOM   151  C  "C2'" . DG  A 1 8  ? 40.625  50.641  184.079 1.00 27.13 ? 8    DG  E "C2'" 1 
ATOM   152  C  "C1'" . DG  A 1 8  ? 41.161  50.434  185.464 1.00 22.76 ? 8    DG  E "C1'" 1 
ATOM   153  N  N9    . DG  A 1 8  ? 41.207  49.031  185.855 1.00 21.52 ? 8    DG  E N9    1 
ATOM   154  C  C8    . DG  A 1 8  ? 40.318  48.026  185.590 1.00 20.30 ? 8    DG  E C8    1 
ATOM   155  N  N7    . DG  A 1 8  ? 40.714  46.851  186.011 1.00 20.67 ? 8    DG  E N7    1 
ATOM   156  C  C5    . DG  A 1 8  ? 41.951  47.105  186.600 1.00 21.28 ? 8    DG  E C5    1 
ATOM   157  C  C6    . DG  A 1 8  ? 42.867  46.203  187.191 1.00 21.69 ? 8    DG  E C6    1 
ATOM   158  O  O6    . DG  A 1 8  ? 42.764  44.982  187.298 1.00 23.84 ? 8    DG  E O6    1 
ATOM   159  N  N1    . DG  A 1 8  ? 44.007  46.856  187.610 1.00 20.12 ? 8    DG  E N1    1 
ATOM   160  C  C2    . DG  A 1 8  ? 44.229  48.205  187.484 1.00 20.21 ? 8    DG  E C2    1 
ATOM   161  N  N2    . DG  A 1 8  ? 45.364  48.648  187.995 1.00 22.10 ? 8    DG  E N2    1 
ATOM   162  N  N3    . DG  A 1 8  ? 43.382  49.070  186.932 1.00 20.10 ? 8    DG  E N3    1 
ATOM   163  C  C4    . DG  A 1 8  ? 42.262  48.439  186.508 1.00 20.64 ? 8    DG  E C4    1 
ATOM   164  P  P     . DG  A 1 9  ? 42.230  53.260  182.733 1.00 36.80 ? 9    DG  E P     1 
ATOM   165  O  OP1   . DG  A 1 9  ? 41.988  54.710  182.579 1.00 41.33 ? 9    DG  E OP1   1 
ATOM   166  O  OP2   . DG  A 1 9  ? 41.857  52.302  181.670 1.00 40.74 ? 9    DG  E OP2   1 
ATOM   167  O  "O5'" . DG  A 1 9  ? 43.756  53.063  183.075 1.00 38.39 ? 9    DG  E "O5'" 1 
ATOM   168  C  "C5'" . DG  A 1 9  ? 44.287  53.787  184.180 1.00 34.09 ? 9    DG  E "C5'" 1 
ATOM   169  C  "C4'" . DG  A 1 9  ? 45.678  53.298  184.469 1.00 34.78 ? 9    DG  E "C4'" 1 
ATOM   170  O  "O4'" . DG  A 1 9  ? 45.672  51.974  185.009 1.00 31.57 ? 9    DG  E "O4'" 1 
ATOM   171  C  "C3'" . DG  A 1 9  ? 46.385  53.162  183.142 1.00 37.53 ? 9    DG  E "C3'" 1 
ATOM   172  O  "O3'" . DG  A 1 9  ? 47.713  53.529  183.350 1.00 41.79 ? 9    DG  E "O3'" 1 
ATOM   173  C  "C2'" . DG  A 1 9  ? 46.301  51.675  182.772 1.00 31.06 ? 9    DG  E "C2'" 1 
ATOM   174  C  "C1'" . DG  A 1 9  ? 46.286  51.030  184.134 1.00 24.53 ? 9    DG  E "C1'" 1 
ATOM   175  N  N9    . DG  A 1 9  ? 45.517  49.781  184.107 1.00 22.78 ? 9    DG  E N9    1 
ATOM   176  C  C8    . DG  A 1 9  ? 44.273  49.557  183.603 1.00 21.21 ? 9    DG  E C8    1 
ATOM   177  N  N7    . DG  A 1 9  ? 43.915  48.304  183.661 1.00 22.54 ? 9    DG  E N7    1 
ATOM   178  C  C5    . DG  A 1 9  ? 44.997  47.649  184.254 1.00 20.78 ? 9    DG  E C5    1 
ATOM   179  C  C6    . DG  A 1 9  ? 45.196  46.271  184.569 1.00 21.85 ? 9    DG  E C6    1 
ATOM   180  O  O6    . DG  A 1 9  ? 44.442  45.316  184.414 1.00 23.32 ? 9    DG  E O6    1 
ATOM   181  N  N1    . DG  A 1 9  ? 46.420  46.042  185.146 1.00 22.33 ? 9    DG  E N1    1 
ATOM   182  C  C2    . DG  A 1 9  ? 47.362  47.013  185.406 1.00 23.71 ? 9    DG  E C2    1 
ATOM   183  N  N2    . DG  A 1 9  ? 48.505  46.606  185.965 1.00 23.68 ? 9    DG  E N2    1 
ATOM   184  N  N3    . DG  A 1 9  ? 47.182  48.308  185.115 1.00 21.99 ? 9    DG  E N3    1 
ATOM   185  C  C4    . DG  A 1 9  ? 45.978  48.553  184.538 1.00 22.47 ? 9    DG  E C4    1 
ATOM   186  P  P     . DG  A 1 10 ? 48.550  53.939  182.077 1.00 46.39 ? 10   DG  E P     1 
ATOM   187  O  OP1   . DG  A 1 10 ? 49.494  54.985  182.535 1.00 45.53 ? 10   DG  E OP1   1 
ATOM   188  O  OP2   . DG  A 1 10 ? 47.626  54.183  180.950 1.00 50.48 ? 10   DG  E OP2   1 
ATOM   189  O  "O5'" . DG  A 1 10 ? 49.342  52.570  181.823 1.00 35.72 ? 10   DG  E "O5'" 1 
ATOM   190  C  "C5'" . DG  A 1 10 ? 50.221  52.332  182.898 1.00 29.48 ? 10   DG  E "C5'" 1 
ATOM   191  C  "C4'" . DG  A 1 10 ? 50.918  51.036  182.815 1.00 26.69 ? 10   DG  E "C4'" 1 
ATOM   192  O  "O4'" . DG  A 1 10 ? 50.045  49.947  183.086 1.00 31.16 ? 10   DG  E "O4'" 1 
ATOM   193  C  "C3'" . DG  A 1 10 ? 51.458  50.850  181.434 1.00 27.75 ? 10   DG  E "C3'" 1 
ATOM   194  O  "O3'" . DG  A 1 10 ? 52.606  50.041  181.595 1.00 33.33 ? 10   DG  E "O3'" 1 
ATOM   195  C  "C2'" . DG  A 1 10 ? 50.344  50.026  180.825 1.00 29.52 ? 10   DG  E "C2'" 1 
ATOM   196  C  "C1'" . DG  A 1 10 ? 50.039  49.086  181.970 1.00 23.01 ? 10   DG  E "C1'" 1 
ATOM   197  N  N9    . DG  A 1 10 ? 48.742  48.445  181.800 1.00 23.14 ? 10   DG  E N9    1 
ATOM   198  C  C8    . DG  A 1 10 ? 47.581  48.957  181.275 1.00 19.52 ? 10   DG  E C8    1 
ATOM   199  N  N7    . DG  A 1 10 ? 46.639  48.057  181.139 1.00 21.92 ? 10   DG  E N7    1 
ATOM   200  C  C5    . DG  A 1 10 ? 47.214  46.879  181.616 1.00 20.34 ? 10   DG  E C5    1 
ATOM   201  C  C6    . DG  A 1 10 ? 46.667  45.571  181.735 1.00 23.30 ? 10   DG  E C6    1 
ATOM   202  O  O6    . DG  A 1 10 ? 45.567  45.174  181.377 1.00 25.05 ? 10   DG  E O6    1 
ATOM   203  N  N1    . DG  A 1 10 ? 47.566  44.675  182.277 1.00 22.13 ? 10   DG  E N1    1 
ATOM   204  C  C2    . DG  A 1 10 ? 48.842  45.009  182.661 1.00 22.50 ? 10   DG  E C2    1 
ATOM   205  N  N2    . DG  A 1 10 ? 49.580  44.020  183.131 1.00 22.34 ? 10   DG  E N2    1 
ATOM   206  N  N3    . DG  A 1 10 ? 49.367  46.240  182.563 1.00 21.76 ? 10   DG  E N3    1 
ATOM   207  C  C4    . DG  A 1 10 ? 48.497  47.116  182.029 1.00 18.93 ? 10   DG  E C4    1 
ATOM   208  P  P     . DG  A 1 11 ? 53.683  49.817  180.449 1.00 37.61 ? 11   DG  E P     1 
ATOM   209  O  OP1   . DG  A 1 11 ? 54.999  50.241  180.976 1.00 44.19 ? 11   DG  E OP1   1 
ATOM   210  O  OP2   . DG  A 1 11 ? 53.180  50.338  179.152 1.00 41.31 ? 11   DG  E OP2   1 
ATOM   211  O  "O5'" . DG  A 1 11 ? 53.656  48.245  180.431 1.00 33.89 ? 11   DG  E "O5'" 1 
ATOM   212  C  "C5'" . DG  A 1 11 ? 54.193  47.698  181.602 1.00 24.34 ? 11   DG  E "C5'" 1 
ATOM   213  C  "C4'" . DG  A 1 11 ? 54.252  46.220  181.484 1.00 30.05 ? 11   DG  E "C4'" 1 
ATOM   214  O  "O4'" . DG  A 1 11 ? 52.932  45.684  181.415 1.00 32.23 ? 11   DG  E "O4'" 1 
ATOM   215  C  "C3'" . DG  A 1 11 ? 54.959  45.789  180.210 1.00 30.52 ? 11   DG  E "C3'" 1 
ATOM   216  O  "O3'" . DG  A 1 11 ? 55.620  44.560  180.500 1.00 34.02 ? 11   DG  E "O3'" 1 
ATOM   217  C  "C2'" . DG  A 1 11 ? 53.777  45.538  179.272 1.00 27.46 ? 11   DG  E "C2'" 1 
ATOM   218  C  "C1'" . DG  A 1 11 ? 52.761  44.921  180.221 1.00 24.64 ? 11   DG  E "C1'" 1 
ATOM   219  N  N9    . DG  A 1 11 ? 51.388  45.130  179.770 1.00 22.25 ? 11   DG  E N9    1 
ATOM   220  C  C8    . DG  A 1 11 ? 50.827  46.284  179.284 1.00 21.60 ? 11   DG  E C8    1 
ATOM   221  N  N7    . DG  A 1 11 ? 49.570  46.147  178.956 1.00 22.60 ? 11   DG  E N7    1 
ATOM   222  C  C5    . DG  A 1 11 ? 49.275  44.812  179.253 1.00 19.93 ? 11   DG  E C5    1 
ATOM   223  C  C6    . DG  A 1 11 ? 48.074  44.077  179.048 1.00 23.82 ? 11   DG  E C6    1 
ATOM   224  O  O6    . DG  A 1 11 ? 47.000  44.485  178.618 1.00 22.87 ? 11   DG  E O6    1 
ATOM   225  N  N1    . DG  A 1 11 ? 48.212  42.749  179.399 1.00 20.71 ? 11   DG  E N1    1 
ATOM   226  C  C2    . DG  A 1 11 ? 49.370  42.191  179.888 1.00 22.22 ? 11   DG  E C2    1 
ATOM   227  N  N2    . DG  A 1 11 ? 49.360  40.870  180.005 1.00 19.52 ? 11   DG  E N2    1 
ATOM   228  N  N3    . DG  A 1 11 ? 50.504  42.879  180.108 1.00 20.46 ? 11   DG  E N3    1 
ATOM   229  C  C4    . DG  A 1 11 ? 50.383  44.182  179.759 1.00 20.70 ? 11   DG  E C4    1 
ATOM   230  P  P     . DT  A 1 12 ? 56.907  44.095  179.700 1.00 39.94 ? 12   DT  E P     1 
ATOM   231  O  OP1   . DT  A 1 12 ? 58.055  44.027  180.615 1.00 45.80 ? 12   DT  E OP1   1 
ATOM   232  O  OP2   . DT  A 1 12 ? 57.004  44.888  178.455 1.00 39.77 ? 12   DT  E OP2   1 
ATOM   233  O  "O5'" . DT  A 1 12 ? 56.479  42.610  179.375 1.00 33.60 ? 12   DT  E "O5'" 1 
ATOM   234  C  "C5'" . DT  A 1 12 ? 55.098  42.355  179.377 1.00 35.21 ? 12   DT  E "C5'" 1 
ATOM   235  C  "C4'" . DT  A 1 12 ? 54.853  40.937  179.012 1.00 36.09 ? 12   DT  E "C4'" 1 
ATOM   236  O  "O4'" . DT  A 1 12 ? 53.466  40.791  178.760 1.00 35.52 ? 12   DT  E "O4'" 1 
ATOM   237  C  "C3'" . DT  A 1 12 ? 55.561  40.552  177.731 1.00 37.02 ? 12   DT  E "C3'" 1 
ATOM   238  O  "O3'" . DT  A 1 12 ? 55.836  39.153  177.785 1.00 39.96 ? 12   DT  E "O3'" 1 
ATOM   239  C  "C2'" . DT  A 1 12 ? 54.499  40.879  176.669 1.00 33.83 ? 12   DT  E "C2'" 1 
ATOM   240  C  "C1'" . DT  A 1 12 ? 53.193  40.566  177.388 1.00 24.95 ? 12   DT  E "C1'" 1 
ATOM   241  N  N1    . DT  A 1 12 ? 52.107  41.494  177.039 1.00 19.88 ? 12   DT  E N1    1 
ATOM   242  C  C2    . DT  A 1 12 ? 50.851  40.954  176.881 1.00 19.47 ? 12   DT  E C2    1 
ATOM   243  O  O2    . DT  A 1 12 ? 50.618  39.766  177.070 1.00 21.52 ? 12   DT  E O2    1 
ATOM   244  N  N3    . DT  A 1 12 ? 49.875  41.811  176.448 1.00 16.38 ? 12   DT  E N3    1 
ATOM   245  C  C4    . DT  A 1 12 ? 50.048  43.150  176.169 1.00 19.47 ? 12   DT  E C4    1 
ATOM   246  O  O4    . DT  A 1 12 ? 49.108  43.805  175.724 1.00 20.50 ? 12   DT  E O4    1 
ATOM   247  C  C5    . DT  A 1 12 ? 51.390  43.639  176.384 1.00 17.30 ? 12   DT  E C5    1 
ATOM   248  C  C7    . DT  A 1 12 ? 51.712  45.118  176.174 1.00 15.81 ? 12   DT  E C7    1 
ATOM   249  C  C6    . DT  A 1 12 ? 52.354  42.812  176.803 1.00 16.44 ? 12   DT  E C6    1 
ATOM   250  P  P     . DG  A 1 13 ? 56.724  38.400  176.680 1.00 43.13 ? 13   DG  E P     1 
ATOM   251  O  OP1   . DG  A 1 13 ? 57.666  37.506  177.390 1.00 47.35 ? 13   DG  E OP1   1 
ATOM   252  O  OP2   . DG  A 1 13 ? 57.219  39.386  175.695 1.00 45.89 ? 13   DG  E OP2   1 
ATOM   253  O  "O5'" . DG  A 1 13 ? 55.631  37.499  175.967 1.00 39.70 ? 13   DG  E "O5'" 1 
ATOM   254  C  "C5'" . DG  A 1 13 ? 54.906  36.611  176.796 1.00 37.17 ? 13   DG  E "C5'" 1 
ATOM   255  C  "C4'" . DG  A 1 13 ? 53.780  35.970  176.026 1.00 37.26 ? 13   DG  E "C4'" 1 
ATOM   256  O  "O4'" . DG  A 1 13 ? 52.750  36.923  175.735 1.00 35.09 ? 13   DG  E "O4'" 1 
ATOM   257  C  "C3'" . DG  A 1 13 ? 54.296  35.451  174.696 1.00 32.76 ? 13   DG  E "C3'" 1 
ATOM   258  O  "O3'" . DG  A 1 13 ? 53.569  34.286  174.365 1.00 38.70 ? 13   DG  E "O3'" 1 
ATOM   259  C  "C2'" . DG  A 1 13 ? 53.909  36.571  173.749 1.00 31.18 ? 13   DG  E "C2'" 1 
ATOM   260  C  "C1'" . DG  A 1 13 ? 52.587  37.036  174.329 1.00 26.80 ? 13   DG  E "C1'" 1 
ATOM   261  N  N9    . DG  A 1 13 ? 52.295  38.439  173.995 1.00 25.43 ? 13   DG  E N9    1 
ATOM   262  C  C8    . DG  A 1 13 ? 53.139  39.519  173.914 1.00 24.53 ? 13   DG  E C8    1 
ATOM   263  N  N7    . DG  A 1 13 ? 52.523  40.655  173.693 1.00 26.13 ? 13   DG  E N7    1 
ATOM   264  C  C5    . DG  A 1 13 ? 51.176  40.291  173.624 1.00 25.12 ? 13   DG  E C5    1 
ATOM   265  C  C6    . DG  A 1 13 ? 50.024  41.083  173.398 1.00 27.09 ? 13   DG  E C6    1 
ATOM   266  O  O6    . DG  A 1 13 ? 49.960  42.298  173.253 1.00 28.08 ? 13   DG  E O6    1 
ATOM   267  N  N1    . DG  A 1 13 ? 48.869  40.326  173.370 1.00 26.57 ? 13   DG  E N1    1 
ATOM   268  C  C2    . DG  A 1 13 ? 48.824  38.965  173.547 1.00 27.44 ? 13   DG  E C2    1 
ATOM   269  N  N2    . DG  A 1 13 ? 47.648  38.363  173.368 1.00 28.85 ? 13   DG  E N2    1 
ATOM   270  N  N3    . DG  A 1 13 ? 49.904  38.227  173.782 1.00 25.58 ? 13   DG  E N3    1 
ATOM   271  C  C4    . DG  A 1 13 ? 51.037  38.947  173.802 1.00 24.86 ? 13   DG  E C4    1 
ATOM   272  P  P     . DA  A 1 14 ? 53.987  33.364  173.121 1.00 42.12 ? 14   DA  E P     1 
ATOM   273  O  OP1   . DA  A 1 14 ? 54.071  31.953  173.566 1.00 43.29 ? 14   DA  E OP1   1 
ATOM   274  O  OP2   . DA  A 1 14 ? 55.114  34.001  172.412 1.00 47.41 ? 14   DA  E OP2   1 
ATOM   275  O  "O5'" . DA  A 1 14 ? 52.667  33.536  172.263 1.00 41.05 ? 14   DA  E "O5'" 1 
ATOM   276  C  "C5'" . DA  A 1 14 ? 51.489  33.252  172.996 1.00 38.32 ? 14   DA  E "C5'" 1 
ATOM   277  C  "C4'" . DA  A 1 14 ? 50.269  33.369  172.152 1.00 33.39 ? 14   DA  E "C4'" 1 
ATOM   278  O  "O4'" . DA  A 1 14 ? 49.886  34.728  171.982 1.00 31.71 ? 14   DA  E "O4'" 1 
ATOM   279  C  "C3'" . DA  A 1 14 ? 50.535  32.824  170.777 1.00 32.95 ? 14   DA  E "C3'" 1 
ATOM   280  O  "O3'" . DA  A 1 14 ? 49.283  32.369  170.328 1.00 43.80 ? 14   DA  E "O3'" 1 
ATOM   281  C  "C2'" . DA  A 1 14 ? 50.917  34.088  170.030 1.00 30.80 ? 14   DA  E "C2'" 1 
ATOM   282  C  "C1'" . DA  A 1 14 ? 49.907  35.054  170.597 1.00 25.59 ? 14   DA  E "C1'" 1 
ATOM   283  N  N9    . DA  A 1 14 ? 50.362  36.424  170.480 1.00 25.88 ? 14   DA  E N9    1 
ATOM   284  C  C8    . DA  A 1 14 ? 51.621  36.899  170.657 1.00 25.91 ? 14   DA  E C8    1 
ATOM   285  N  N7    . DA  A 1 14 ? 51.700  38.202  170.594 1.00 26.69 ? 14   DA  E N7    1 
ATOM   286  C  C5    . DA  A 1 14 ? 50.397  38.605  170.349 1.00 23.67 ? 14   DA  E C5    1 
ATOM   287  C  C6    . DA  A 1 14 ? 49.825  39.863  170.173 1.00 26.96 ? 14   DA  E C6    1 
ATOM   288  N  N6    . DA  A 1 14 ? 50.547  40.981  170.136 1.00 23.51 ? 14   DA  E N6    1 
ATOM   289  N  N1    . DA  A 1 14 ? 48.498  39.908  169.978 1.00 24.73 ? 14   DA  E N1    1 
ATOM   290  C  C2    . DA  A 1 14 ? 47.809  38.773  169.951 1.00 24.29 ? 14   DA  E C2    1 
ATOM   291  N  N3    . DA  A 1 14 ? 48.239  37.529  170.088 1.00 26.04 ? 14   DA  E N3    1 
ATOM   292  C  C4    . DA  A 1 14 ? 49.570  37.524  170.289 1.00 23.06 ? 14   DA  E C4    1 
ATOM   293  P  P     . DT  A 1 15 ? 49.122  31.425  169.058 1.00 53.13 ? 15   DT  E P     1 
ATOM   294  O  OP1   . DT  A 1 15 ? 48.052  30.450  169.392 1.00 52.97 ? 15   DT  E OP1   1 
ATOM   295  O  OP2   . DT  A 1 15 ? 50.465  30.963  168.626 1.00 57.95 ? 15   DT  E OP2   1 
ATOM   296  O  "O5'" . DT  A 1 15 ? 48.576  32.465  167.964 1.00 44.98 ? 15   DT  E "O5'" 1 
ATOM   297  C  "C5'" . DT  A 1 15 ? 47.342  33.027  168.318 1.00 39.29 ? 15   DT  E "C5'" 1 
ATOM   298  C  "C4'" . DT  A 1 15 ? 47.000  34.248  167.543 1.00 39.80 ? 15   DT  E "C4'" 1 
ATOM   299  O  "O4'" . DT  A 1 15 ? 47.827  35.364  167.890 1.00 39.48 ? 15   DT  E "O4'" 1 
ATOM   300  C  "C3'" . DT  A 1 15 ? 47.119  34.038  166.061 1.00 42.50 ? 15   DT  E "C3'" 1 
ATOM   301  O  "O3'" . DT  A 1 15 ? 45.948  34.589  165.482 1.00 50.81 ? 15   DT  E "O3'" 1 
ATOM   302  C  "C2'" . DT  A 1 15 ? 48.287  34.970  165.704 1.00 40.36 ? 15   DT  E "C2'" 1 
ATOM   303  C  "C1'" . DT  A 1 15 ? 48.075  36.094  166.701 1.00 35.62 ? 15   DT  E "C1'" 1 
ATOM   304  N  N1    . DT  A 1 15 ? 49.214  37.009  166.875 1.00 33.93 ? 15   DT  E N1    1 
ATOM   305  C  C2    . DT  A 1 15 ? 48.992  38.367  166.728 1.00 33.27 ? 15   DT  E C2    1 
ATOM   306  O  O2    . DT  A 1 15 ? 47.888  38.836  166.456 1.00 33.72 ? 15   DT  E O2    1 
ATOM   307  N  N3    . DT  A 1 15 ? 50.101  39.183  166.868 1.00 33.24 ? 15   DT  E N3    1 
ATOM   308  C  C4    . DT  A 1 15 ? 51.389  38.763  167.125 1.00 31.87 ? 15   DT  E C4    1 
ATOM   309  O  O4    . DT  A 1 15 ? 52.306  39.578  167.213 1.00 33.11 ? 15   DT  E O4    1 
ATOM   310  C  C5    . DT  A 1 15 ? 51.516  37.333  167.256 1.00 33.59 ? 15   DT  E C5    1 
ATOM   311  C  C7    . DT  A 1 15 ? 52.868  36.711  167.511 1.00 33.38 ? 15   DT  E C7    1 
ATOM   312  C  C6    . DT  A 1 15 ? 50.457  36.521  167.138 1.00 34.00 ? 15   DT  E C6    1 
ATOM   313  P  P     . DC  A 1 16 ? 45.461  34.092  164.042 1.00 53.17 ? 16   DC  E P     1 
ATOM   314  O  OP1   . DC  A 1 16 ? 44.272  33.229  164.230 1.00 54.10 ? 16   DC  E OP1   1 
ATOM   315  O  OP2   . DC  A 1 16 ? 46.650  33.623  163.285 1.00 51.42 ? 16   DC  E OP2   1 
ATOM   316  O  "O5'" . DC  A 1 16 ? 44.977  35.464  163.409 1.00 49.25 ? 16   DC  E "O5'" 1 
ATOM   317  C  "C5'" . DC  A 1 16 ? 44.407  36.403  164.297 1.00 41.76 ? 16   DC  E "C5'" 1 
ATOM   318  C  "C4'" . DC  A 1 16 ? 44.508  37.803  163.745 1.00 38.29 ? 16   DC  E "C4'" 1 
ATOM   319  O  "O4'" . DC  A 1 16 ? 45.749  38.403  164.097 1.00 39.13 ? 16   DC  E "O4'" 1 
ATOM   320  C  "C3'" . DC  A 1 16 ? 44.464  37.853  162.235 1.00 37.21 ? 16   DC  E "C3'" 1 
ATOM   321  O  "O3'" . DC  A 1 16 ? 43.731  39.004  161.912 1.00 41.05 ? 16   DC  E "O3'" 1 
ATOM   322  C  "C2'" . DC  A 1 16 ? 45.908  38.118  161.834 1.00 31.47 ? 16   DC  E "C2'" 1 
ATOM   323  C  "C1'" . DC  A 1 16 ? 46.349  39.011  162.961 1.00 26.71 ? 16   DC  E "C1'" 1 
ATOM   324  N  N1    . DC  A 1 16 ? 47.803  39.052  163.175 1.00 24.24 ? 16   DC  E N1    1 
ATOM   325  C  C2    . DC  A 1 16 ? 48.371  40.302  163.256 1.00 25.42 ? 16   DC  E C2    1 
ATOM   326  O  O2    . DC  A 1 16 ? 47.662  41.288  163.070 1.00 26.41 ? 16   DC  E O2    1 
ATOM   327  N  N3    . DC  A 1 16 ? 49.711  40.398  163.487 1.00 25.33 ? 16   DC  E N3    1 
ATOM   328  C  C4    . DC  A 1 16 ? 50.457  39.291  163.613 1.00 22.97 ? 16   DC  E C4    1 
ATOM   329  N  N4    . DC  A 1 16 ? 51.770  39.401  163.786 1.00 23.03 ? 16   DC  E N4    1 
ATOM   330  C  C5    . DC  A 1 16 ? 49.878  37.992  163.527 1.00 24.00 ? 16   DC  E C5    1 
ATOM   331  C  C6    . DC  A 1 16 ? 48.548  37.923  163.314 1.00 24.44 ? 16   DC  E C6    1 
ATOM   332  P  P     . DT  A 1 17 ? 42.944  39.031  160.541 1.00 42.96 ? 17   DT  E P     1 
ATOM   333  O  OP1   . DT  A 1 17 ? 41.540  39.394  160.824 1.00 47.17 ? 17   DT  E OP1   1 
ATOM   334  O  OP2   . DT  A 1 17 ? 43.278  37.801  159.779 1.00 41.92 ? 17   DT  E OP2   1 
ATOM   335  O  "O5'" . DT  A 1 17 ? 43.667  40.296  159.893 1.00 43.38 ? 17   DT  E "O5'" 1 
ATOM   336  C  "C5'" . DT  A 1 17 ? 44.018  41.369  160.757 1.00 38.22 ? 17   DT  E "C5'" 1 
ATOM   337  C  "C4'" . DT  A 1 17 ? 44.764  42.439  160.008 1.00 38.90 ? 17   DT  E "C4'" 1 
ATOM   338  O  "O4'" . DT  A 1 17 ? 46.165  42.379  160.282 1.00 37.71 ? 17   DT  E "O4'" 1 
ATOM   339  C  "C3'" . DT  A 1 17 ? 44.633  42.252  158.503 1.00 40.68 ? 17   DT  E "C3'" 1 
ATOM   340  O  "O3'" . DT  A 1 17 ? 44.763  43.535  157.880 1.00 47.84 ? 17   DT  E "O3'" 1 
ATOM   341  C  "C2'" . DT  A 1 17 ? 45.863  41.392  158.204 1.00 37.40 ? 17   DT  E "C2'" 1 
ATOM   342  C  "C1'" . DT  A 1 17 ? 46.875  42.103  159.082 1.00 31.49 ? 17   DT  E "C1'" 1 
ATOM   343  N  N1    . DT  A 1 17 ? 48.042  41.302  159.417 1.00 26.99 ? 17   DT  E N1    1 
ATOM   344  C  C2    . DT  A 1 17 ? 49.173  42.002  159.745 1.00 28.70 ? 17   DT  E C2    1 
ATOM   345  O  O2    . DT  A 1 17 ? 49.217  43.223  159.657 1.00 28.86 ? 17   DT  E O2    1 
ATOM   346  N  N3    . DT  A 1 17 ? 50.258  41.257  160.130 1.00 27.14 ? 17   DT  E N3    1 
ATOM   347  C  C4    . DT  A 1 17 ? 50.299  39.882  160.202 1.00 26.63 ? 17   DT  E C4    1 
ATOM   348  O  O4    . DT  A 1 17 ? 51.310  39.300  160.586 1.00 29.54 ? 17   DT  E O4    1 
ATOM   349  C  C5    . DT  A 1 17 ? 49.070  39.234  159.825 1.00 29.20 ? 17   DT  E C5    1 
ATOM   350  C  C7    . DT  A 1 17 ? 49.006  37.716  159.813 1.00 27.33 ? 17   DT  E C7    1 
ATOM   351  C  C6    . DT  A 1 17 ? 47.998  39.947  159.456 1.00 28.54 ? 17   DT  E C6    1 
ATOM   352  O  "O5'" . DC  B 2 1  ? 46.774  42.691  155.021 1.00 60.60 ? 18   DC  F "O5'" 1 
ATOM   353  C  "C5'" . DC  B 2 1  ? 46.386  43.998  155.474 1.00 50.45 ? 18   DC  F "C5'" 1 
ATOM   354  C  "C4'" . DC  B 2 1  ? 47.567  44.940  155.508 1.00 45.50 ? 18   DC  F "C4'" 1 
ATOM   355  O  "O4'" . DC  B 2 1  ? 48.439  44.587  156.582 1.00 39.18 ? 18   DC  F "O4'" 1 
ATOM   356  C  "C3'" . DC  B 2 1  ? 48.321  44.678  154.228 1.00 46.16 ? 18   DC  F "C3'" 1 
ATOM   357  O  "O3'" . DC  B 2 1  ? 48.966  45.780  153.624 1.00 57.14 ? 18   DC  F "O3'" 1 
ATOM   358  C  "C2'" . DC  B 2 1  ? 49.421  43.764  154.661 1.00 39.71 ? 18   DC  F "C2'" 1 
ATOM   359  C  "C1'" . DC  B 2 1  ? 49.701  44.191  156.069 1.00 29.49 ? 18   DC  F "C1'" 1 
ATOM   360  N  N1    . DC  B 2 1  ? 50.228  42.970  156.666 1.00 24.90 ? 18   DC  F N1    1 
ATOM   361  C  C2    . DC  B 2 1  ? 51.530  43.022  157.110 1.00 26.03 ? 18   DC  F C2    1 
ATOM   362  O  O2    . DC  B 2 1  ? 52.062  44.114  157.308 1.00 27.15 ? 18   DC  F O2    1 
ATOM   363  N  N3    . DC  B 2 1  ? 52.187  41.855  157.344 1.00 24.73 ? 18   DC  F N3    1 
ATOM   364  C  C4    . DC  B 2 1  ? 51.574  40.679  157.163 1.00 23.28 ? 18   DC  F C4    1 
ATOM   365  N  N4    . DC  B 2 1  ? 52.236  39.555  157.446 1.00 24.95 ? 18   DC  F N4    1 
ATOM   366  C  C5    . DC  B 2 1  ? 50.210  40.615  156.728 1.00 24.18 ? 18   DC  F C5    1 
ATOM   367  C  C6    . DC  B 2 1  ? 49.579  41.786  156.500 1.00 24.28 ? 18   DC  F C6    1 
ATOM   368  P  P     . DA  B 2 2  ? 49.700  45.476  152.208 1.00 54.06 ? 19   DA  F P     1 
ATOM   369  O  OP1   . DA  B 2 2  ? 49.403  46.618  151.317 1.00 65.30 ? 19   DA  F OP1   1 
ATOM   370  O  OP2   . DA  B 2 2  ? 49.402  44.083  151.780 1.00 53.80 ? 19   DA  F OP2   1 
ATOM   371  O  "O5'" . DA  B 2 2  ? 51.227  45.574  152.654 1.00 52.36 ? 19   DA  F "O5'" 1 
ATOM   372  C  "C5'" . DA  B 2 2  ? 51.561  46.688  153.476 1.00 47.47 ? 19   DA  F "C5'" 1 
ATOM   373  C  "C4'" . DA  B 2 2  ? 53.021  46.961  153.391 1.00 43.45 ? 19   DA  F "C4'" 1 
ATOM   374  O  "O4'" . DA  B 2 2  ? 53.684  46.082  154.304 1.00 40.37 ? 19   DA  F "O4'" 1 
ATOM   375  C  "C3'" . DA  B 2 2  ? 53.472  46.589  151.989 1.00 48.01 ? 19   DA  F "C3'" 1 
ATOM   376  O  "O3'" . DA  B 2 2  ? 54.457  47.464  151.449 1.00 60.38 ? 19   DA  F "O3'" 1 
ATOM   377  C  "C2'" . DA  B 2 2  ? 54.063  45.192  152.144 1.00 38.46 ? 19   DA  F "C2'" 1 
ATOM   378  C  "C1'" . DA  B 2 2  ? 54.440  45.083  153.622 1.00 32.06 ? 19   DA  F "C1'" 1 
ATOM   379  N  N9    . DA  B 2 2  ? 54.014  43.751  154.061 1.00 25.80 ? 19   DA  F N9    1 
ATOM   380  C  C8    . DA  B 2 2  ? 52.816  43.154  153.801 1.00 23.42 ? 19   DA  F C8    1 
ATOM   381  N  N7    . DA  B 2 2  ? 52.801  41.874  154.056 1.00 25.07 ? 19   DA  F N7    1 
ATOM   382  C  C5    . DA  B 2 2  ? 54.069  41.609  154.544 1.00 23.34 ? 19   DA  F C5    1 
ATOM   383  C  C6    . DA  B 2 2  ? 54.677  40.433  154.988 1.00 24.88 ? 19   DA  F C6    1 
ATOM   384  N  N6    . DA  B 2 2  ? 54.033  39.266  155.049 1.00 23.56 ? 19   DA  F N6    1 
ATOM   385  N  N1    . DA  B 2 2  ? 55.955  40.516  155.382 1.00 23.74 ? 19   DA  F N1    1 
ATOM   386  C  C2    . DA  B 2 2  ? 56.574  41.690  155.335 1.00 24.22 ? 19   DA  F C2    1 
ATOM   387  N  N3    . DA  B 2 2  ? 56.105  42.865  154.941 1.00 25.95 ? 19   DA  F N3    1 
ATOM   388  C  C4    . DA  B 2 2  ? 54.818  42.748  154.553 1.00 23.41 ? 19   DA  F C4    1 
ATOM   389  P  P     . DT  B 2 3  ? 54.903  47.292  149.896 1.00 58.13 ? 20   DT  F P     1 
ATOM   390  O  OP1   . DT  B 2 3  ? 55.073  48.650  149.329 1.00 67.37 ? 20   DT  F OP1   1 
ATOM   391  O  OP2   . DT  B 2 3  ? 54.021  46.306  149.220 1.00 63.22 ? 20   DT  F OP2   1 
ATOM   392  O  "O5'" . DT  B 2 3  ? 56.353  46.628  150.078 1.00 61.38 ? 20   DT  F "O5'" 1 
ATOM   393  C  "C5'" . DT  B 2 3  ? 57.154  47.189  151.109 1.00 49.31 ? 20   DT  F "C5'" 1 
ATOM   394  C  "C4'" . DT  B 2 3  ? 58.404  46.398  151.360 1.00 45.60 ? 20   DT  F "C4'" 1 
ATOM   395  O  "O4'" . DT  B 2 3  ? 58.109  45.191  152.070 1.00 39.61 ? 20   DT  F "O4'" 1 
ATOM   396  C  "C3'" . DT  B 2 3  ? 59.038  46.003  150.040 1.00 49.36 ? 20   DT  F "C3'" 1 
ATOM   397  O  "O3'" . DT  B 2 3  ? 60.456  46.122  150.185 1.00 60.45 ? 20   DT  F "O3'" 1 
ATOM   398  C  "C2'" . DT  B 2 3  ? 58.615  44.534  149.902 1.00 39.01 ? 20   DT  F "C2'" 1 
ATOM   399  C  "C1'" . DT  B 2 3  ? 58.560  44.057  151.343 1.00 32.18 ? 20   DT  F "C1'" 1 
ATOM   400  N  N1    . DT  B 2 3  ? 57.597  42.953  151.495 1.00 27.25 ? 20   DT  F N1    1 
ATOM   401  C  C2    . DT  B 2 3  ? 58.053  41.781  152.086 1.00 27.12 ? 20   DT  F C2    1 
ATOM   402  O  O2    . DT  B 2 3  ? 59.206  41.632  152.493 1.00 27.87 ? 20   DT  F O2    1 
ATOM   403  N  N3    . DT  B 2 3  ? 57.126  40.757  152.178 1.00 24.67 ? 20   DT  F N3    1 
ATOM   404  C  C4    . DT  B 2 3  ? 55.812  40.792  151.743 1.00 24.61 ? 20   DT  F C4    1 
ATOM   405  O  O4    . DT  B 2 3  ? 55.104  39.790  151.804 1.00 25.09 ? 20   DT  F O4    1 
ATOM   406  C  C5    . DT  B 2 3  ? 55.421  42.053  151.161 1.00 24.70 ? 20   DT  F C5    1 
ATOM   407  C  C7    . DT  B 2 3  ? 53.968  42.229  150.724 1.00 24.09 ? 20   DT  F C7    1 
ATOM   408  C  C6    . DT  B 2 3  ? 56.302  43.074  151.051 1.00 25.81 ? 20   DT  F C6    1 
ATOM   409  P  P     . DG  B 2 4  ? 61.506  45.762  149.016 1.00 58.35 ? 21   DG  F P     1 
ATOM   410  O  OP1   . DG  B 2 4  ? 62.819  46.326  149.414 1.00 68.08 ? 21   DG  F OP1   1 
ATOM   411  O  OP2   . DG  B 2 4  ? 60.906  46.078  147.695 1.00 63.55 ? 21   DG  F OP2   1 
ATOM   412  O  "O5'" . DG  B 2 4  ? 61.569  44.179  149.185 1.00 55.65 ? 21   DG  F "O5'" 1 
ATOM   413  C  "C5'" . DG  B 2 4  ? 62.128  43.728  150.404 1.00 46.15 ? 21   DG  F "C5'" 1 
ATOM   414  C  "C4'" . DG  B 2 4  ? 62.865  42.457  150.191 1.00 40.26 ? 21   DG  F "C4'" 1 
ATOM   415  O  "O4'" . DG  B 2 4  ? 61.992  41.365  150.466 1.00 41.11 ? 21   DG  F "O4'" 1 
ATOM   416  C  "C3'" . DG  B 2 4  ? 63.248  42.340  148.740 1.00 40.95 ? 21   DG  F "C3'" 1 
ATOM   417  O  "O3'" . DG  B 2 4  ? 64.491  41.649  148.678 1.00 44.42 ? 21   DG  F "O3'" 1 
ATOM   418  C  "C2'" . DG  B 2 4  ? 62.078  41.539  148.150 1.00 38.75 ? 21   DG  F "C2'" 1 
ATOM   419  C  "C1'" . DG  B 2 4  ? 61.680  40.625  149.303 1.00 31.99 ? 21   DG  F "C1'" 1 
ATOM   420  N  N9    . DG  B 2 4  ? 60.241  40.307  149.321 1.00 26.93 ? 21   DG  F N9    1 
ATOM   421  C  C8    . DG  B 2 4  ? 59.177  41.043  148.872 1.00 26.02 ? 21   DG  F C8    1 
ATOM   422  N  N7    . DG  B 2 4  ? 58.029  40.399  148.905 1.00 25.83 ? 21   DG  F N7    1 
ATOM   423  C  C5    . DG  B 2 4  ? 58.364  39.156  149.425 1.00 24.65 ? 21   DG  F C5    1 
ATOM   424  C  C6    . DG  B 2 4  ? 57.547  38.028  149.668 1.00 24.51 ? 21   DG  F C6    1 
ATOM   425  O  O6    . DG  B 2 4  ? 56.335  37.933  149.508 1.00 26.20 ? 21   DG  F O6    1 
ATOM   426  N  N1    . DG  B 2 4  ? 58.271  36.961  150.158 1.00 23.44 ? 21   DG  F N1    1 
ATOM   427  C  C2    . DG  B 2 4  ? 59.626  36.982  150.394 1.00 23.38 ? 21   DG  F C2    1 
ATOM   428  N  N2    . DG  B 2 4  ? 60.191  35.846  150.797 1.00 23.99 ? 21   DG  F N2    1 
ATOM   429  N  N3    . DG  B 2 4  ? 60.402  38.048  150.184 1.00 24.94 ? 21   DG  F N3    1 
ATOM   430  C  C4    . DG  B 2 4  ? 59.705  39.095  149.691 1.00 24.74 ? 21   DG  F C4    1 
ATOM   431  P  P     . DA  B 2 5  ? 65.216  41.420  147.277 1.00 43.97 ? 22   DA  F P     1 
ATOM   432  O  OP1   . DA  B 2 5  ? 66.683  41.521  147.473 1.00 40.84 ? 22   DA  F OP1   1 
ATOM   433  O  OP2   . DA  B 2 5  ? 64.517  42.238  146.263 1.00 41.53 ? 22   DA  F OP2   1 
ATOM   434  O  "O5'" . DA  B 2 5  ? 64.865  39.881  147.016 1.00 40.79 ? 22   DA  F "O5'" 1 
ATOM   435  C  "C5'" . DA  B 2 5  ? 65.543  38.885  147.775 1.00 31.94 ? 22   DA  F "C5'" 1 
ATOM   436  C  "C4'" . DA  B 2 5  ? 64.936  37.516  147.536 1.00 33.48 ? 22   DA  F "C4'" 1 
ATOM   437  O  "O4'" . DA  B 2 5  ? 63.547  37.406  147.919 1.00 31.84 ? 22   DA  F "O4'" 1 
ATOM   438  C  "C3'" . DA  B 2 5  ? 64.948  37.241  146.058 1.00 34.29 ? 22   DA  F "C3'" 1 
ATOM   439  O  "O3'" . DA  B 2 5  ? 65.157  35.864  145.863 1.00 41.40 ? 22   DA  F "O3'" 1 
ATOM   440  C  "C2'" . DA  B 2 5  ? 63.525  37.530  145.645 1.00 31.94 ? 22   DA  F "C2'" 1 
ATOM   441  C  "C1'" . DA  B 2 5  ? 62.814  36.908  146.821 1.00 22.55 ? 22   DA  F "C1'" 1 
ATOM   442  N  N9    . DA  B 2 5  ? 61.421  37.304  146.785 1.00 18.67 ? 22   DA  F N9    1 
ATOM   443  C  C8    . DA  B 2 5  ? 60.893  38.447  146.269 1.00 18.18 ? 22   DA  F C8    1 
ATOM   444  N  N7    . DA  B 2 5  ? 59.596  38.425  146.147 1.00 17.86 ? 22   DA  F N7    1 
ATOM   445  C  C5    . DA  B 2 5  ? 59.250  37.179  146.635 1.00 17.64 ? 22   DA  F C5    1 
ATOM   446  C  C6    . DA  B 2 5  ? 58.024  36.570  146.809 1.00 18.20 ? 22   DA  F C6    1 
ATOM   447  N  N6    . DA  B 2 5  ? 56.894  37.157  146.428 1.00 21.07 ? 22   DA  F N6    1 
ATOM   448  N  N1    . DA  B 2 5  ? 58.014  35.350  147.335 1.00 18.07 ? 22   DA  F N1    1 
ATOM   449  C  C2    . DA  B 2 5  ? 59.164  34.776  147.662 1.00 16.53 ? 22   DA  F C2    1 
ATOM   450  N  N3    . DA  B 2 5  ? 60.390  35.245  147.554 1.00 16.40 ? 22   DA  F N3    1 
ATOM   451  C  C4    . DA  B 2 5  ? 60.353  36.484  147.025 1.00 18.16 ? 22   DA  F C4    1 
ATOM   452  P  P     . DG  B 2 6  ? 66.437  35.533  145.011 1.00 45.02 ? 23   DG  F P     1 
ATOM   453  O  OP1   . DG  B 2 6  ? 67.618  35.726  145.882 1.00 52.19 ? 23   DG  F OP1   1 
ATOM   454  O  OP2   . DG  B 2 6  ? 66.320  36.239  143.708 1.00 41.94 ? 23   DG  F OP2   1 
ATOM   455  O  "O5'" . DG  B 2 6  ? 66.221  33.977  144.815 1.00 44.07 ? 23   DG  F "O5'" 1 
ATOM   456  C  "C5'" . DG  B 2 6  ? 66.257  33.180  145.980 1.00 35.37 ? 23   DG  F "C5'" 1 
ATOM   457  C  "C4'" . DG  B 2 6  ? 65.180  32.120  145.940 1.00 31.29 ? 23   DG  F "C4'" 1 
ATOM   458  O  "O4'" . DG  B 2 6  ? 63.902  32.762  145.991 1.00 27.30 ? 23   DG  F "O4'" 1 
ATOM   459  C  "C3'" . DG  B 2 6  ? 65.213  31.306  144.650 1.00 29.11 ? 23   DG  F "C3'" 1 
ATOM   460  O  "O3'" . DG  B 2 6  ? 65.008  29.944  145.018 1.00 30.13 ? 23   DG  F "O3'" 1 
ATOM   461  C  "C2'" . DG  B 2 6  ? 64.012  31.876  143.878 1.00 27.52 ? 23   DG  F "C2'" 1 
ATOM   462  C  "C1'" . DG  B 2 6  ? 63.047  32.255  144.990 1.00 21.40 ? 23   DG  F "C1'" 1 
ATOM   463  N  N9    . DG  B 2 6  ? 62.093  33.300  144.609 1.00 18.34 ? 23   DG  F N9    1 
ATOM   464  C  C8    . DG  B 2 6  ? 62.327  34.564  144.153 1.00 18.37 ? 23   DG  F C8    1 
ATOM   465  N  N7    . DG  B 2 6  ? 61.224  35.237  143.884 1.00 17.70 ? 23   DG  F N7    1 
ATOM   466  C  C5    . DG  B 2 6  ? 60.196  34.350  144.183 1.00 19.00 ? 23   DG  F C5    1 
ATOM   467  C  C6    . DG  B 2 6  ? 58.787  34.506  144.078 1.00 20.98 ? 23   DG  F C6    1 
ATOM   468  O  O6    . DG  B 2 6  ? 58.126  35.492  143.743 1.00 20.42 ? 23   DG  F O6    1 
ATOM   469  N  N1    . DG  B 2 6  ? 58.129  33.360  144.464 1.00 17.62 ? 23   DG  F N1    1 
ATOM   470  C  C2    . DG  B 2 6  ? 58.735  32.209  144.914 1.00 20.50 ? 23   DG  F C2    1 
ATOM   471  N  N2    . DG  B 2 6  ? 57.923  31.214  145.274 1.00 20.61 ? 23   DG  F N2    1 
ATOM   472  N  N3    . DG  B 2 6  ? 60.052  32.064  145.023 1.00 19.70 ? 23   DG  F N3    1 
ATOM   473  C  C4    . DG  B 2 6  ? 60.720  33.168  144.634 1.00 14.96 ? 23   DG  F C4    1 
ATOM   474  P  P     . DA  B 2 7  ? 64.638  28.784  143.985 1.00 31.52 ? 24   DA  F P     1 
ATOM   475  O  OP1   . DA  B 2 7  ? 64.949  27.482  144.605 1.00 29.85 ? 24   DA  F OP1   1 
ATOM   476  O  OP2   . DA  B 2 7  ? 65.189  29.122  142.654 1.00 35.74 ? 24   DA  F OP2   1 
ATOM   477  O  "O5'" . DA  B 2 7  ? 63.044  28.975  143.959 1.00 28.86 ? 24   DA  F "O5'" 1 
ATOM   478  C  "C5'" . DA  B 2 7  ? 62.323  28.323  144.993 1.00 25.99 ? 24   DA  F "C5'" 1 
ATOM   479  C  "C4'" . DA  B 2 7  ? 60.950  27.872  144.560 1.00 24.37 ? 24   DA  F "C4'" 1 
ATOM   480  O  "O4'" . DA  B 2 7  ? 60.209  29.008  144.129 1.00 25.43 ? 24   DA  F "O4'" 1 
ATOM   481  C  "C3'" . DA  B 2 7  ? 60.957  26.897  143.390 1.00 27.88 ? 24   DA  F "C3'" 1 
ATOM   482  O  "O3'" . DA  B 2 7  ? 59.832  26.030  143.534 1.00 32.90 ? 24   DA  F "O3'" 1 
ATOM   483  C  "C2'" . DA  B 2 7  ? 60.688  27.846  142.223 1.00 26.63 ? 24   DA  F "C2'" 1 
ATOM   484  C  "C1'" . DA  B 2 7  ? 59.686  28.820  142.827 1.00 20.33 ? 24   DA  F "C1'" 1 
ATOM   485  N  N9    . DA  B 2 7  ? 59.731  30.128  142.192 1.00 21.84 ? 24   DA  F N9    1 
ATOM   486  C  C8    . DA  B 2 7  ? 60.835  30.892  141.889 1.00 21.55 ? 24   DA  F C8    1 
ATOM   487  N  N7    . DA  B 2 7  ? 60.545  32.101  141.473 1.00 20.71 ? 24   DA  F N7    1 
ATOM   488  C  C5    . DA  B 2 7  ? 59.155  32.134  141.501 1.00 19.20 ? 24   DA  F C5    1 
ATOM   489  C  C6    . DA  B 2 7  ? 58.228  33.112  141.109 1.00 24.56 ? 24   DA  F C6    1 
ATOM   490  N  N6    . DA  B 2 7  ? 58.607  34.329  140.705 1.00 22.45 ? 24   DA  F N6    1 
ATOM   491  N  N1    . DA  B 2 7  ? 56.922  32.792  141.172 1.00 20.92 ? 24   DA  F N1    1 
ATOM   492  C  C2    . DA  B 2 7  ? 56.590  31.587  141.610 1.00 21.42 ? 24   DA  F C2    1 
ATOM   493  N  N3    . DA  B 2 7  ? 57.368  30.580  142.018 1.00 22.55 ? 24   DA  F N3    1 
ATOM   494  C  C4    . DA  B 2 7  ? 58.656  30.933  141.932 1.00 19.95 ? 24   DA  F C4    1 
ATOM   495  P  P     . DT  B 2 8  ? 59.718  24.622  142.790 1.00 31.40 ? 25   DT  F P     1 
ATOM   496  O  OP1   . DT  B 2 8  ? 59.240  23.619  143.756 1.00 32.00 ? 25   DT  F OP1   1 
ATOM   497  O  OP2   . DT  B 2 8  ? 60.938  24.378  141.991 1.00 30.76 ? 25   DT  F OP2   1 
ATOM   498  O  "O5'" . DT  B 2 8  ? 58.532  24.948  141.821 1.00 20.86 ? 25   DT  F "O5'" 1 
ATOM   499  C  "C5'" . DT  B 2 8  ? 57.432  25.526  142.443 1.00 17.37 ? 25   DT  F "C5'" 1 
ATOM   500  C  "C4'" . DT  B 2 8  ? 56.376  25.862  141.448 1.00 21.21 ? 25   DT  F "C4'" 1 
ATOM   501  O  "O4'" . DT  B 2 8  ? 56.561  27.235  141.087 1.00 24.61 ? 25   DT  F "O4'" 1 
ATOM   502  C  "C3'" . DT  B 2 8  ? 56.450  25.032  140.170 1.00 25.96 ? 25   DT  F "C3'" 1 
ATOM   503  O  "O3'" . DT  B 2 8  ? 55.147  24.569  139.809 1.00 26.52 ? 25   DT  F "O3'" 1 
ATOM   504  C  "C2'" . DT  B 2 8  ? 56.929  26.074  139.144 1.00 22.93 ? 25   DT  F "C2'" 1 
ATOM   505  C  "C1'" . DT  B 2 8  ? 56.380  27.383  139.695 1.00 19.41 ? 25   DT  F "C1'" 1 
ATOM   506  N  N1    . DT  B 2 8  ? 57.100  28.592  139.267 1.00 21.12 ? 25   DT  F N1    1 
ATOM   507  C  C2    . DT  B 2 8  ? 56.334  29.688  138.926 1.00 18.26 ? 25   DT  F C2    1 
ATOM   508  O  O2    . DT  B 2 8  ? 55.109  29.698  139.020 1.00 19.82 ? 25   DT  F O2    1 
ATOM   509  N  N3    . DT  B 2 8  ? 57.022  30.799  138.490 1.00 19.58 ? 25   DT  F N3    1 
ATOM   510  C  C4    . DT  B 2 8  ? 58.395  30.907  138.384 1.00 22.93 ? 25   DT  F C4    1 
ATOM   511  O  O4    . DT  B 2 8  ? 58.904  31.993  138.114 1.00 21.53 ? 25   DT  F O4    1 
ATOM   512  C  C5    . DT  B 2 8  ? 59.113  29.711  138.763 1.00 16.38 ? 25   DT  F C5    1 
ATOM   513  C  C7    . DT  B 2 8  ? 60.627  29.707  138.727 1.00 16.79 ? 25   DT  F C7    1 
ATOM   514  C  C6    . DT  B 2 8  ? 58.467  28.613  139.182 1.00 17.85 ? 25   DT  F C6    1 
ATOM   515  P  P     . DC  B 2 9  ? 54.950  23.332  138.807 1.00 24.58 ? 26   DC  F P     1 
ATOM   516  O  OP1   . DC  B 2 9  ? 53.865  22.445  139.267 1.00 27.34 ? 26   DC  F OP1   1 
ATOM   517  O  OP2   . DC  B 2 9  ? 56.278  22.778  138.470 1.00 25.19 ? 26   DC  F OP2   1 
ATOM   518  O  "O5'" . DC  B 2 9  ? 54.401  24.166  137.607 1.00 26.28 ? 26   DC  F "O5'" 1 
ATOM   519  C  "C5'" . DC  B 2 9  ? 53.178  24.778  137.914 1.00 21.71 ? 26   DC  F "C5'" 1 
ATOM   520  C  "C4'" . DC  B 2 9  ? 52.796  25.863  136.958 1.00 24.85 ? 26   DC  F "C4'" 1 
ATOM   521  O  "O4'" . DC  B 2 9  ? 53.701  26.985  137.045 1.00 29.49 ? 26   DC  F "O4'" 1 
ATOM   522  C  "C3'" . DC  B 2 9  ? 52.839  25.351  135.545 1.00 30.61 ? 26   DC  F "C3'" 1 
ATOM   523  O  "O3'" . DC  B 2 9  ? 51.615  25.554  134.874 1.00 31.44 ? 26   DC  F "O3'" 1 
ATOM   524  C  "C2'" . DC  B 2 9  ? 53.873  26.269  134.881 1.00 31.32 ? 26   DC  F "C2'" 1 
ATOM   525  C  "C1'" . DC  B 2 9  ? 53.846  27.533  135.744 1.00 25.10 ? 26   DC  F "C1'" 1 
ATOM   526  N  N1    . DC  B 2 9  ? 55.090  28.336  135.634 1.00 21.37 ? 26   DC  F N1    1 
ATOM   527  C  C2    . DC  B 2 9  ? 54.991  29.690  135.302 1.00 23.80 ? 26   DC  F C2    1 
ATOM   528  O  O2    . DC  B 2 9  ? 53.894  30.235  135.131 1.00 22.03 ? 26   DC  F O2    1 
ATOM   529  N  N3    . DC  B 2 9  ? 56.148  30.384  135.118 1.00 21.84 ? 26   DC  F N3    1 
ATOM   530  C  C4    . DC  B 2 9  ? 57.331  29.780  135.245 1.00 21.31 ? 26   DC  F C4    1 
ATOM   531  N  N4    . DC  B 2 9  ? 58.438  30.485  135.074 1.00 22.71 ? 26   DC  F N4    1 
ATOM   532  C  C5    . DC  B 2 9  ? 57.443  28.401  135.583 1.00 21.85 ? 26   DC  F C5    1 
ATOM   533  C  C6    . DC  B 2 9  ? 56.294  27.727  135.773 1.00 22.22 ? 26   DC  F C6    1 
ATOM   534  P  P     . DA  B 2 10 ? 51.332  24.652  133.586 1.00 29.37 ? 27   DA  F P     1 
ATOM   535  O  OP1   . DA  B 2 10 ? 50.053  23.943  133.779 1.00 32.15 ? 27   DA  F OP1   1 
ATOM   536  O  OP2   . DA  B 2 10 ? 52.564  23.924  133.208 1.00 26.62 ? 27   DA  F OP2   1 
ATOM   537  O  "O5'" . DA  B 2 10 ? 51.092  25.854  132.581 1.00 30.52 ? 27   DA  F "O5'" 1 
ATOM   538  C  "C5'" . DA  B 2 10 ? 50.194  26.866  133.023 1.00 26.27 ? 27   DA  F "C5'" 1 
ATOM   539  C  "C4'" . DA  B 2 10 ? 50.160  28.043  132.081 1.00 25.71 ? 27   DA  F "C4'" 1 
ATOM   540  O  "O4'" . DA  B 2 10 ? 51.348  28.818  132.245 1.00 25.60 ? 27   DA  F "O4'" 1 
ATOM   541  C  "C3'" . DA  B 2 10 ? 50.140  27.586  130.630 1.00 27.30 ? 27   DA  F "C3'" 1 
ATOM   542  O  "O3'" . DA  B 2 10 ? 49.346  28.512  129.899 1.00 32.28 ? 27   DA  F "O3'" 1 
ATOM   543  C  "C2'" . DA  B 2 10 ? 51.609  27.686  130.218 1.00 21.73 ? 27   DA  F "C2'" 1 
ATOM   544  C  "C1'" . DA  B 2 10 ? 52.082  28.862  131.041 1.00 20.43 ? 27   DA  F "C1'" 1 
ATOM   545  N  N9    . DA  B 2 10 ? 53.467  28.707  131.419 1.00 21.82 ? 27   DA  F N9    1 
ATOM   546  C  C8    . DA  B 2 10 ? 54.171  27.564  131.679 1.00 22.55 ? 27   DA  F C8    1 
ATOM   547  N  N7    . DA  B 2 10 ? 55.444  27.778  131.897 1.00 21.70 ? 27   DA  F N7    1 
ATOM   548  C  C5    . DA  B 2 10 ? 55.583  29.163  131.771 1.00 23.67 ? 27   DA  F C5    1 
ATOM   549  C  C6    . DA  B 2 10 ? 56.686  30.027  131.875 1.00 18.96 ? 27   DA  F C6    1 
ATOM   550  N  N6    . DA  B 2 10 ? 57.895  29.622  132.245 1.00 20.45 ? 27   DA  F N6    1 
ATOM   551  N  N1    . DA  B 2 10 ? 56.467  31.327  131.683 1.00 22.19 ? 27   DA  F N1    1 
ATOM   552  C  C2    . DA  B 2 10 ? 55.237  31.740  131.425 1.00 21.26 ? 27   DA  F C2    1 
ATOM   553  N  N3    . DA  B 2 10 ? 54.111  31.045  131.306 1.00 21.31 ? 27   DA  F N3    1 
ATOM   554  C  C4    . DA  B 2 10 ? 54.372  29.734  131.490 1.00 22.27 ? 27   DA  F C4    1 
ATOM   555  P  P     . DC  B 2 11 ? 48.973  28.279  128.362 1.00 34.80 ? 28   DC  F P     1 
ATOM   556  O  OP1   . DC  B 2 11 ? 47.568  28.701  128.183 1.00 34.33 ? 28   DC  F OP1   1 
ATOM   557  O  OP2   . DC  B 2 11 ? 49.433  26.916  127.985 1.00 37.38 ? 28   DC  F OP2   1 
ATOM   558  O  "O5'" . DC  B 2 11 ? 49.890  29.328  127.599 1.00 30.58 ? 28   DC  F "O5'" 1 
ATOM   559  C  "C5'" . DC  B 2 11 ? 49.953  30.628  128.147 1.00 26.24 ? 28   DC  F "C5'" 1 
ATOM   560  C  "C4'" . DC  B 2 11 ? 51.062  31.434  127.544 1.00 22.82 ? 28   DC  F "C4'" 1 
ATOM   561  O  "O4'" . DC  B 2 11 ? 52.307  31.181  128.194 1.00 25.02 ? 28   DC  F "O4'" 1 
ATOM   562  C  "C3'" . DC  B 2 11 ? 51.256  31.036  126.107 1.00 27.63 ? 28   DC  F "C3'" 1 
ATOM   563  O  "O3'" . DC  B 2 11 ? 51.421  32.232  125.348 1.00 37.39 ? 28   DC  F "O3'" 1 
ATOM   564  C  "C2'" . DC  B 2 11 ? 52.558  30.228  126.164 1.00 22.74 ? 28   DC  F "C2'" 1 
ATOM   565  C  "C1'" . DC  B 2 11 ? 53.317  30.946  127.241 1.00 18.40 ? 28   DC  F "C1'" 1 
ATOM   566  N  N1    . DC  B 2 11 ? 54.412  30.144  127.799 1.00 19.75 ? 28   DC  F N1    1 
ATOM   567  C  C2    . DC  B 2 11 ? 55.578  30.792  128.157 1.00 23.74 ? 28   DC  F C2    1 
ATOM   568  O  O2    . DC  B 2 11 ? 55.675  32.010  128.035 1.00 24.52 ? 28   DC  F O2    1 
ATOM   569  N  N3    . DC  B 2 11 ? 56.631  30.055  128.591 1.00 20.67 ? 28   DC  F N3    1 
ATOM   570  C  C4    . DC  B 2 11 ? 56.535  28.733  128.669 1.00 18.65 ? 28   DC  F C4    1 
ATOM   571  N  N4    . DC  B 2 11 ? 57.552  28.034  129.160 1.00 20.27 ? 28   DC  F N4    1 
ATOM   572  C  C5    . DC  B 2 11 ? 55.343  28.053  128.306 1.00 18.32 ? 28   DC  F C5    1 
ATOM   573  C  C6    . DC  B 2 11 ? 54.310  28.802  127.879 1.00 19.92 ? 28   DC  F C6    1 
ATOM   574  P  P     . DC  B 2 12 ? 51.347  32.235  123.748 1.00 40.29 ? 29   DC  F P     1 
ATOM   575  O  OP1   . DC  B 2 12 ? 50.340  33.228  123.313 1.00 40.10 ? 29   DC  F OP1   1 
ATOM   576  O  OP2   . DC  B 2 12 ? 51.277  30.826  123.295 1.00 45.07 ? 29   DC  F OP2   1 
ATOM   577  O  "O5'" . DC  B 2 12 ? 52.791  32.823  123.462 1.00 36.12 ? 29   DC  F "O5'" 1 
ATOM   578  C  "C5'" . DC  B 2 12 ? 52.930  34.081  124.085 1.00 31.22 ? 29   DC  F "C5'" 1 
ATOM   579  C  "C4'" . DC  B 2 12 ? 54.312  34.617  123.966 1.00 33.59 ? 29   DC  F "C4'" 1 
ATOM   580  O  "O4'" . DC  B 2 12 ? 55.141  33.907  124.871 1.00 32.71 ? 29   DC  F "O4'" 1 
ATOM   581  C  "C3'" . DC  B 2 12 ? 54.863  34.336  122.599 1.00 35.06 ? 29   DC  F "C3'" 1 
ATOM   582  O  "O3'" . DC  B 2 12 ? 55.375  35.460  121.935 1.00 41.73 ? 29   DC  F "O3'" 1 
ATOM   583  C  "C2'" . DC  B 2 12 ? 56.053  33.420  122.800 1.00 37.44 ? 29   DC  F "C2'" 1 
ATOM   584  C  "C1'" . DC  B 2 12 ? 56.353  33.477  124.281 1.00 26.13 ? 29   DC  F "C1'" 1 
ATOM   585  N  N1    . DC  B 2 12 ? 56.626  32.101  124.723 1.00 27.76 ? 29   DC  F N1    1 
ATOM   586  C  C2    . DC  B 2 12 ? 57.936  31.791  125.039 1.00 27.29 ? 29   DC  F C2    1 
ATOM   587  O  O2    . DC  B 2 12 ? 58.790  32.665  124.950 1.00 27.95 ? 29   DC  F O2    1 
ATOM   588  N  N3    . DC  B 2 12 ? 58.254  30.498  125.299 1.00 27.75 ? 29   DC  F N3    1 
ATOM   589  C  C4    . DC  B 2 12 ? 57.304  29.551  125.227 1.00 24.71 ? 29   DC  F C4    1 
ATOM   590  N  N4    . DC  B 2 12 ? 57.634  28.285  125.441 1.00 24.82 ? 29   DC  F N4    1 
ATOM   591  C  C5    . DC  B 2 12 ? 55.947  29.850  124.898 1.00 24.30 ? 29   DC  F C5    1 
ATOM   592  C  C6    . DC  B 2 12 ? 55.650  31.143  124.658 1.00 26.07 ? 29   DC  F C6    1 
ATOM   593  P  P     . DC  B 2 13 ? 55.380  35.285  120.355 1.00 38.16 ? 30   DC  F P     1 
ATOM   594  O  OP1   . DC  B 2 13 ? 55.191  36.614  119.748 1.00 43.04 ? 30   DC  F OP1   1 
ATOM   595  O  OP2   . DC  B 2 13 ? 54.500  34.148  119.996 1.00 45.52 ? 30   DC  F OP2   1 
ATOM   596  O  "O5'" . DC  B 2 13 ? 56.888  34.847  120.193 1.00 33.24 ? 30   DC  F "O5'" 1 
ATOM   597  C  "C5'" . DC  B 2 13 ? 57.744  35.852  120.668 1.00 31.59 ? 30   DC  F "C5'" 1 
ATOM   598  C  "C4'" . DC  B 2 13 ? 59.145  35.413  120.573 1.00 33.74 ? 30   DC  F "C4'" 1 
ATOM   599  O  "O4'" . DC  B 2 13 ? 59.329  34.292  121.423 1.00 37.02 ? 30   DC  F "O4'" 1 
ATOM   600  C  "C3'" . DC  B 2 13 ? 59.419  34.958  119.160 1.00 38.45 ? 30   DC  F "C3'" 1 
ATOM   601  O  "O3'" . DC  B 2 13 ? 60.739  35.346  118.804 1.00 46.47 ? 30   DC  F "O3'" 1 
ATOM   602  C  "C2'" . DC  B 2 13 ? 59.351  33.442  119.276 1.00 34.69 ? 30   DC  F "C2'" 1 
ATOM   603  C  "C1'" . DC  B 2 13 ? 59.893  33.222  120.676 1.00 30.44 ? 30   DC  F "C1'" 1 
ATOM   604  N  N1    . DC  B 2 13 ? 59.471  31.921  121.223 1.00 26.55 ? 30   DC  F N1    1 
ATOM   605  C  C2    . DC  B 2 13 ? 60.443  31.110  121.766 1.00 26.50 ? 30   DC  F C2    1 
ATOM   606  O  O2    . DC  B 2 13 ? 61.607  31.494  121.776 1.00 28.19 ? 30   DC  F O2    1 
ATOM   607  N  N3    . DC  B 2 13 ? 60.093  29.871  122.195 1.00 25.57 ? 30   DC  F N3    1 
ATOM   608  C  C4    . DC  B 2 13 ? 58.831  29.454  122.068 1.00 24.51 ? 30   DC  F C4    1 
ATOM   609  N  N4    . DC  B 2 13 ? 58.504  28.214  122.414 1.00 25.17 ? 30   DC  F N4    1 
ATOM   610  C  C5    . DC  B 2 13 ? 57.819  30.286  121.509 1.00 25.21 ? 30   DC  F C5    1 
ATOM   611  C  C6    . DC  B 2 13 ? 58.187  31.515  121.110 1.00 26.16 ? 30   DC  F C6    1 
ATOM   612  P  P     . DC  B 2 14 ? 61.215  35.309  117.275 1.00 46.19 ? 31   DC  F P     1 
ATOM   613  O  OP1   . DC  B 2 14 ? 61.941  36.567  116.997 1.00 49.30 ? 31   DC  F OP1   1 
ATOM   614  O  OP2   . DC  B 2 14 ? 60.086  34.869  116.421 1.00 46.46 ? 31   DC  F OP2   1 
ATOM   615  O  "O5'" . DC  B 2 14 ? 62.261  34.127  117.391 1.00 38.72 ? 31   DC  F "O5'" 1 
ATOM   616  C  "C5'" . DC  B 2 14 ? 63.312  34.386  118.287 1.00 33.96 ? 31   DC  F "C5'" 1 
ATOM   617  C  "C4'" . DC  B 2 14 ? 64.223  33.213  118.388 1.00 35.80 ? 31   DC  F "C4'" 1 
ATOM   618  O  "O4'" . DC  B 2 14 ? 63.600  32.147  119.100 1.00 36.92 ? 31   DC  F "O4'" 1 
ATOM   619  C  "C3'" . DC  B 2 14 ? 64.508  32.688  117.020 1.00 42.96 ? 31   DC  F "C3'" 1 
ATOM   620  O  "O3'" . DC  B 2 14 ? 65.869  32.299  116.972 1.00 55.80 ? 31   DC  F "O3'" 1 
ATOM   621  C  "C2'" . DC  B 2 14 ? 63.609  31.456  116.929 1.00 38.76 ? 31   DC  F "C2'" 1 
ATOM   622  C  "C1'" . DC  B 2 14 ? 63.623  30.946  118.351 1.00 31.43 ? 31   DC  F "C1'" 1 
ATOM   623  N  N1    . DC  B 2 14 ? 62.427  30.139  118.673 1.00 30.57 ? 31   DC  F N1    1 
ATOM   624  C  C2    . DC  B 2 14 ? 62.618  28.906  119.285 1.00 29.99 ? 31   DC  F C2    1 
ATOM   625  O  O2    . DC  B 2 14 ? 63.751  28.554  119.613 1.00 30.90 ? 31   DC  F O2    1 
ATOM   626  N  N3    . DC  B 2 14 ? 61.530  28.127  119.528 1.00 27.93 ? 31   DC  F N3    1 
ATOM   627  C  C4    . DC  B 2 14 ? 60.301  28.548  119.180 1.00 27.77 ? 31   DC  F C4    1 
ATOM   628  N  N4    . DC  B 2 14 ? 59.238  27.764  119.378 1.00 26.87 ? 31   DC  F N4    1 
ATOM   629  C  C5    . DC  B 2 14 ? 60.096  29.823  118.566 1.00 27.48 ? 31   DC  F C5    1 
ATOM   630  C  C6    . DC  B 2 14 ? 61.187  30.580  118.336 1.00 28.62 ? 31   DC  F C6    1 
ATOM   631  P  P     . DA  B 2 15 ? 66.477  31.956  115.532 1.00 55.63 ? 32   DA  F P     1 
ATOM   632  O  OP1   . DA  B 2 15 ? 67.812  32.594  115.432 1.00 65.05 ? 32   DA  F OP1   1 
ATOM   633  O  OP2   . DA  B 2 15 ? 65.422  32.184  114.500 1.00 57.33 ? 32   DA  F OP2   1 
ATOM   634  O  "O5'" . DA  B 2 15 ? 66.706  30.383  115.715 1.00 59.94 ? 32   DA  F "O5'" 1 
ATOM   635  C  "C5'" . DA  B 2 15 ? 67.573  29.986  116.765 1.00 48.46 ? 32   DA  F "C5'" 1 
ATOM   636  C  "C4'" . DA  B 2 15 ? 67.740  28.493  116.783 1.00 44.26 ? 32   DA  F "C4'" 1 
ATOM   637  O  "O4'" . DA  B 2 15 ? 66.542  27.868  117.241 1.00 41.58 ? 32   DA  F "O4'" 1 
ATOM   638  C  "C3'" . DA  B 2 15 ? 68.007  27.951  115.391 1.00 39.83 ? 32   DA  F "C3'" 1 
ATOM   639  O  "O3'" . DA  B 2 15 ? 68.905  26.857  115.556 1.00 52.32 ? 32   DA  F "O3'" 1 
ATOM   640  C  "C2'" . DA  B 2 15 ? 66.622  27.466  114.962 1.00 35.93 ? 32   DA  F "C2'" 1 
ATOM   641  C  "C1'" . DA  B 2 15 ? 66.071  26.936  116.276 1.00 32.13 ? 32   DA  F "C1'" 1 
ATOM   642  N  N9    . DA  B 2 15 ? 64.604  26.919  116.321 1.00 28.07 ? 32   DA  F N9    1 
ATOM   643  C  C8    . DA  B 2 15 ? 63.728  27.859  115.853 1.00 26.71 ? 32   DA  F C8    1 
ATOM   644  N  N7    . DA  B 2 15 ? 62.474  27.553  116.049 1.00 25.78 ? 32   DA  F N7    1 
ATOM   645  C  C5    . DA  B 2 15 ? 62.525  26.323  116.698 1.00 24.18 ? 32   DA  F C5    1 
ATOM   646  C  C6    . DA  B 2 15 ? 61.525  25.449  117.126 1.00 24.49 ? 32   DA  F C6    1 
ATOM   647  N  N6    . DA  B 2 15 ? 60.225  25.743  117.041 1.00 21.67 ? 32   DA  F N6    1 
ATOM   648  N  N1    . DA  B 2 15 ? 61.922  24.292  117.671 1.00 23.57 ? 32   DA  F N1    1 
ATOM   649  C  C2    . DA  B 2 15 ? 63.217  24.034  117.790 1.00 24.77 ? 32   DA  F C2    1 
ATOM   650  N  N3    . DA  B 2 15 ? 64.256  24.774  117.431 1.00 26.96 ? 32   DA  F N3    1 
ATOM   651  C  C4    . DA  B 2 15 ? 63.822  25.927  116.874 1.00 25.12 ? 32   DA  F C4    1 
ATOM   652  P  P     . DC  B 2 16 ? 69.819  26.306  114.361 1.00 57.53 ? 33   DC  F P     1 
ATOM   653  O  OP1   . DC  B 2 16 ? 71.198  26.097  114.864 1.00 59.52 ? 33   DC  F OP1   1 
ATOM   654  O  OP2   . DC  B 2 16 ? 69.565  27.123  113.155 1.00 59.50 ? 33   DC  F OP2   1 
ATOM   655  O  "O5'" . DC  B 2 16 ? 69.151  24.872  114.156 1.00 57.49 ? 33   DC  F "O5'" 1 
ATOM   656  C  "C5'" . DC  B 2 16 ? 69.230  23.958  115.244 1.00 47.55 ? 33   DC  F "C5'" 1 
ATOM   657  C  "C4'" . DC  B 2 16 ? 68.299  22.785  115.051 1.00 44.35 ? 33   DC  F "C4'" 1 
ATOM   658  O  "O4'" . DC  B 2 16 ? 66.963  23.162  115.392 1.00 40.01 ? 33   DC  F "O4'" 1 
ATOM   659  C  "C3'" . DC  B 2 16 ? 68.244  22.365  113.591 1.00 47.40 ? 33   DC  F "C3'" 1 
ATOM   660  O  "O3'" . DC  B 2 16 ? 68.160  20.959  113.460 1.00 57.04 ? 33   DC  F "O3'" 1 
ATOM   661  C  "C2'" . DC  B 2 16 ? 66.898  22.915  113.136 1.00 40.14 ? 33   DC  F "C2'" 1 
ATOM   662  C  "C1'" . DC  B 2 16 ? 66.100  22.714  114.379 1.00 28.65 ? 33   DC  F "C1'" 1 
ATOM   663  N  N1    . DC  B 2 16 ? 64.823  23.414  114.367 1.00 25.60 ? 33   DC  F N1    1 
ATOM   664  C  C2    . DC  B 2 16 ? 63.748  22.664  114.778 1.00 29.84 ? 33   DC  F C2    1 
ATOM   665  O  O2    . DC  B 2 16 ? 63.946  21.626  115.403 1.00 29.81 ? 33   DC  F O2    1 
ATOM   666  N  N3    . DC  B 2 16 ? 62.494  23.138  114.586 1.00 26.72 ? 33   DC  F N3    1 
ATOM   667  C  C4    . DC  B 2 16 ? 62.309  24.335  114.027 1.00 25.63 ? 33   DC  F C4    1 
ATOM   668  N  N4    . DC  B 2 16 ? 61.058  24.772  113.848 1.00 24.48 ? 33   DC  F N4    1 
ATOM   669  C  C5    . DC  B 2 16 ? 63.428  25.143  113.627 1.00 25.93 ? 33   DC  F C5    1 
ATOM   670  C  C6    . DC  B 2 16 ? 64.665  24.637  113.820 1.00 24.28 ? 33   DC  F C6    1 
ATOM   671  P  P     . DT  B 2 17 ? 69.514  20.101  113.515 1.00 55.15 ? 34   DT  F P     1 
ATOM   672  O  OP1   . DT  B 2 17 ? 70.312  20.538  114.686 1.00 63.66 ? 34   DT  F OP1   1 
ATOM   673  O  OP2   . DT  B 2 17 ? 70.116  20.083  112.167 1.00 67.35 ? 34   DT  F OP2   1 
ATOM   674  O  "O5'" . DT  B 2 17 ? 68.848  18.672  113.819 1.00 62.16 ? 34   DT  F "O5'" 1 
ATOM   675  C  "C5'" . DT  B 2 17 ? 67.745  18.742  114.723 1.00 56.82 ? 34   DT  F "C5'" 1 
ATOM   676  C  "C4'" . DT  B 2 17 ? 66.583  17.852  114.349 1.00 52.29 ? 34   DT  F "C4'" 1 
ATOM   677  O  "O4'" . DT  B 2 17 ? 65.408  18.623  114.096 1.00 46.67 ? 34   DT  F "O4'" 1 
ATOM   678  C  "C3'" . DT  B 2 17 ? 66.831  17.016  113.102 1.00 54.58 ? 34   DT  F "C3'" 1 
ATOM   679  O  "O3'" . DT  B 2 17 ? 66.117  15.785  113.301 1.00 59.66 ? 34   DT  F "O3'" 1 
ATOM   680  C  "C2'" . DT  B 2 17 ? 66.119  17.878  112.054 1.00 45.94 ? 34   DT  F "C2'" 1 
ATOM   681  C  "C1'" . DT  B 2 17 ? 64.877  18.215  112.851 1.00 38.51 ? 34   DT  F "C1'" 1 
ATOM   682  N  N1    . DT  B 2 17 ? 63.996  19.254  112.306 1.00 31.57 ? 34   DT  F N1    1 
ATOM   683  C  C2    . DT  B 2 17 ? 62.642  19.076  112.561 1.00 32.88 ? 34   DT  F C2    1 
ATOM   684  O  O2    . DT  B 2 17 ? 62.186  18.025  113.025 1.00 31.29 ? 34   DT  F O2    1 
ATOM   685  N  N3    . DT  B 2 17 ? 61.817  20.112  112.179 1.00 30.17 ? 34   DT  F N3    1 
ATOM   686  C  C4    . DT  B 2 17 ? 62.232  21.280  111.570 1.00 30.50 ? 34   DT  F C4    1 
ATOM   687  O  O4    . DT  B 2 17 ? 61.431  22.165  111.282 1.00 32.39 ? 34   DT  F O4    1 
ATOM   688  C  C5    . DT  B 2 17 ? 63.645  21.369  111.334 1.00 30.74 ? 34   DT  F C5    1 
ATOM   689  C  C7    . DT  B 2 17 ? 64.162  22.645  110.698 1.00 28.91 ? 34   DT  F C7    1 
ATOM   690  C  C6    . DT  B 2 17 ? 64.478  20.378  111.692 1.00 29.78 ? 34   DT  F C6    1 
ATOM   691  P  P     . DG  B 2 18 ? 66.599  14.408  112.623 1.00 56.77 ? 35   DG  F P     1 
ATOM   692  O  OP1   . DG  B 2 18 ? 66.944  13.443  113.690 1.00 64.53 ? 35   DG  F OP1   1 
ATOM   693  O  OP2   . DG  B 2 18 ? 67.575  14.738  111.558 1.00 57.93 ? 35   DG  F OP2   1 
ATOM   694  O  "O5'" . DG  B 2 18 ? 65.233  13.906  111.962 1.00 57.79 ? 35   DG  F "O5'" 1 
ATOM   695  C  "C5'" . DG  B 2 18 ? 64.103  13.665  112.799 1.00 43.69 ? 35   DG  F "C5'" 1 
ATOM   696  C  "C4'" . DG  B 2 18 ? 62.852  13.471  111.971 1.00 39.63 ? 35   DG  F "C4'" 1 
ATOM   697  O  "O4'" . DG  B 2 18 ? 62.292  14.724  111.552 1.00 37.05 ? 35   DG  F "O4'" 1 
ATOM   698  C  "C3'" . DG  B 2 18 ? 63.196  12.747  110.674 1.00 42.46 ? 35   DG  F "C3'" 1 
ATOM   699  O  "O3'" . DG  B 2 18 ? 61.996  12.177  110.150 1.00 52.34 ? 35   DG  F "O3'" 1 
ATOM   700  C  "C2'" . DG  B 2 18 ? 63.574  13.933  109.778 1.00 36.70 ? 35   DG  F "C2'" 1 
ATOM   701  C  "C1'" . DG  B 2 18 ? 62.402  14.828  110.130 1.00 32.42 ? 35   DG  F "C1'" 1 
ATOM   702  N  N9    . DG  B 2 18 ? 62.552  16.214  109.672 1.00 28.13 ? 35   DG  F N9    1 
ATOM   703  C  C8    . DG  B 2 18 ? 63.677  16.906  109.282 1.00 26.06 ? 35   DG  F C8    1 
ATOM   704  N  N7    . DG  B 2 18 ? 63.433  18.162  108.973 1.00 25.47 ? 35   DG  F N7    1 
ATOM   705  C  C5    . DG  B 2 18 ? 62.063  18.294  109.165 1.00 21.73 ? 35   DG  F C5    1 
ATOM   706  C  C6    . DG  B 2 18 ? 61.240  19.411  108.989 1.00 25.57 ? 35   DG  F C6    1 
ATOM   707  O  O6    . DG  B 2 18 ? 61.574  20.529  108.622 1.00 26.12 ? 35   DG  F O6    1 
ATOM   708  N  N1    . DG  B 2 18 ? 59.922  19.139  109.284 1.00 21.83 ? 35   DG  F N1    1 
ATOM   709  C  C2    . DG  B 2 18 ? 59.451  17.920  109.703 1.00 23.85 ? 35   DG  F C2    1 
ATOM   710  N  N2    . DG  B 2 18 ? 58.133  17.824  109.898 1.00 24.16 ? 35   DG  F N2    1 
ATOM   711  N  N3    . DG  B 2 18 ? 60.238  16.852  109.882 1.00 24.40 ? 35   DG  F N3    1 
ATOM   712  C  C4    . DG  B 2 18 ? 61.522  17.116  109.590 1.00 20.66 ? 35   DG  F C4    1 
ATOM   713  P  P     . DC  B 2 19 ? 61.607  10.637  110.347 1.00 55.99 ? 36   DC  F P     1 
ATOM   714  O  OP1   . DC  B 2 19 ? 61.441  10.391  111.799 1.00 59.30 ? 36   DC  F OP1   1 
ATOM   715  O  OP2   . DC  B 2 19 ? 62.519  9.805   109.530 1.00 53.53 ? 36   DC  F OP2   1 
ATOM   716  O  "O5'" . DC  B 2 19 ? 60.162  10.582  109.678 1.00 51.09 ? 36   DC  F "O5'" 1 
ATOM   717  C  "C5'" . DC  B 2 19 ? 59.081  11.058  110.462 1.00 45.05 ? 36   DC  F "C5'" 1 
ATOM   718  C  "C4'" . DC  B 2 19 ? 58.117  11.872  109.637 1.00 40.13 ? 36   DC  F "C4'" 1 
ATOM   719  O  "O4'" . DC  B 2 19 ? 58.658  13.139  109.246 1.00 36.98 ? 36   DC  F "O4'" 1 
ATOM   720  C  "C3'" . DC  B 2 19 ? 57.800  11.134  108.355 1.00 40.47 ? 36   DC  F "C3'" 1 
ATOM   721  O  "O3'" . DC  B 2 19 ? 56.467  11.436  108.015 1.00 43.78 ? 36   DC  F "O3'" 1 
ATOM   722  C  "C2'" . DC  B 2 19 ? 58.715  11.822  107.368 1.00 35.27 ? 36   DC  F "C2'" 1 
ATOM   723  C  "C1'" . DC  B 2 19 ? 58.571  13.255  107.825 1.00 32.05 ? 36   DC  F "C1'" 1 
ATOM   724  N  N1    . DC  B 2 19 ? 59.617  14.132  107.260 1.00 28.72 ? 36   DC  F N1    1 
ATOM   725  C  C2    . DC  B 2 19 ? 59.228  15.392  106.847 1.00 30.73 ? 36   DC  F C2    1 
ATOM   726  O  O2    . DC  B 2 19 ? 58.031  15.689  106.838 1.00 30.39 ? 36   DC  F O2    1 
ATOM   727  N  N3    . DC  B 2 19 ? 60.187  16.248  106.412 1.00 28.28 ? 36   DC  F N3    1 
ATOM   728  C  C4    . DC  B 2 19 ? 61.476  15.879  106.373 1.00 28.24 ? 36   DC  F C4    1 
ATOM   729  N  N4    . DC  B 2 19 ? 62.420  16.760  106.021 1.00 30.04 ? 36   DC  F N4    1 
ATOM   730  C  C5    . DC  B 2 19 ? 61.880  14.568  106.771 1.00 30.12 ? 36   DC  F C5    1 
ATOM   731  C  C6    . DC  B 2 19 ? 60.914  13.734  107.210 1.00 29.49 ? 36   DC  F C6    1 
ATOM   732  P  P     . DA  B 2 20 ? 55.446  10.224  107.896 1.00 52.75 ? 37   DA  F P     1 
ATOM   733  O  OP1   . DA  B 2 20 ? 55.123  9.678   109.232 1.00 49.62 ? 37   DA  F OP1   1 
ATOM   734  O  OP2   . DA  B 2 20 ? 55.974  9.340   106.832 1.00 63.05 ? 37   DA  F OP2   1 
ATOM   735  O  "O5'" . DA  B 2 20 ? 54.153  10.998  107.360 1.00 54.19 ? 37   DA  F "O5'" 1 
ATOM   736  C  "C5'" . DA  B 2 20 ? 53.916  12.324  107.836 1.00 53.21 ? 37   DA  F "C5'" 1 
ATOM   737  C  "C4'" . DA  B 2 20 ? 53.348  13.247  106.760 1.00 51.66 ? 37   DA  F "C4'" 1 
ATOM   738  O  "O4'" . DA  B 2 20 ? 54.371  13.963  106.052 1.00 47.15 ? 37   DA  F "O4'" 1 
ATOM   739  C  "C3'" . DA  B 2 20 ? 52.600  12.440  105.715 1.00 54.50 ? 37   DA  F "C3'" 1 
ATOM   740  O  "O3'" . DA  B 2 20 ? 51.535  13.253  105.206 1.00 64.35 ? 37   DA  F "O3'" 1 
ATOM   741  C  "C2'" . DA  B 2 20 ? 53.703  12.190  104.674 1.00 41.18 ? 37   DA  F "C2'" 1 
ATOM   742  C  "C1'" . DA  B 2 20 ? 54.452  13.518  104.698 1.00 33.93 ? 37   DA  F "C1'" 1 
ATOM   743  N  N9    . DA  B 2 20 ? 55.865  13.336  104.369 1.00 25.20 ? 37   DA  F N9    1 
ATOM   744  C  C8    . DA  B 2 20 ? 56.618  12.206  104.475 1.00 26.06 ? 37   DA  F C8    1 
ATOM   745  N  N7    . DA  B 2 20 ? 57.888  12.381  104.208 1.00 25.17 ? 37   DA  F N7    1 
ATOM   746  C  C5    . DA  B 2 20 ? 57.977  13.723  103.911 1.00 22.08 ? 37   DA  F C5    1 
ATOM   747  C  C6    . DA  B 2 20 ? 59.062  14.524  103.578 1.00 22.75 ? 37   DA  F C6    1 
ATOM   748  N  N6    . DA  B 2 20 ? 60.312  14.050  103.458 1.00 23.30 ? 37   DA  F N6    1 
ATOM   749  N  N1    . DA  B 2 20 ? 58.806  15.820  103.369 1.00 23.56 ? 37   DA  F N1    1 
ATOM   750  C  C2    . DA  B 2 20 ? 57.563  16.263  103.478 1.00 23.71 ? 37   DA  F C2    1 
ATOM   751  N  N3    . DA  B 2 20 ? 56.455  15.605  103.786 1.00 24.45 ? 37   DA  F N3    1 
ATOM   752  C  C4    . DA  B 2 20 ? 56.750  14.313  103.999 1.00 25.24 ? 37   DA  F C4    1 
ATOM   753  P  P     . DA  B 2 21 ? 50.350  12.597  104.329 1.00 62.59 ? 38   DA  F P     1 
ATOM   754  O  OP1   . DA  B 2 21 ? 49.288  12.092  105.239 1.00 65.13 ? 38   DA  F OP1   1 
ATOM   755  O  OP2   . DA  B 2 21 ? 50.964  11.701  103.311 1.00 65.91 ? 38   DA  F OP2   1 
ATOM   756  O  "O5'" . DA  B 2 21 ? 49.790  13.884  103.566 1.00 63.89 ? 38   DA  F "O5'" 1 
ATOM   757  C  "C5'" . DA  B 2 21 ? 50.001  13.938  102.165 1.00 54.03 ? 38   DA  F "C5'" 1 
ATOM   758  C  "C4'" . DA  B 2 21 ? 50.911  15.076  101.823 1.00 48.24 ? 38   DA  F "C4'" 1 
ATOM   759  O  "O4'" . DA  B 2 21 ? 52.277  14.766  102.114 1.00 46.79 ? 38   DA  F "O4'" 1 
ATOM   760  C  "C3'" . DA  B 2 21 ? 50.823  15.309  100.332 1.00 47.59 ? 38   DA  F "C3'" 1 
ATOM   761  O  "O3'" . DA  B 2 21 ? 51.084  16.685  100.036 1.00 51.41 ? 38   DA  F "O3'" 1 
ATOM   762  C  "C2'" . DA  B 2 21 ? 51.972  14.433  99.859  1.00 45.35 ? 38   DA  F "C2'" 1 
ATOM   763  C  "C1'" . DA  B 2 21 ? 53.020  14.783  100.891 1.00 38.77 ? 38   DA  F "C1'" 1 
ATOM   764  N  N9    . DA  B 2 21 ? 54.174  13.853  100.850 1.00 33.51 ? 38   DA  F N9    1 
ATOM   765  C  C8    . DA  B 2 21 ? 54.229  12.508  101.152 1.00 31.27 ? 38   DA  F C8    1 
ATOM   766  N  N7    . DA  B 2 21 ? 55.440  12.011  101.080 1.00 31.19 ? 38   DA  F N7    1 
ATOM   767  C  C5    . DA  B 2 21 ? 56.240  13.089  100.702 1.00 27.57 ? 38   DA  F C5    1 
ATOM   768  C  C6    . DA  B 2 21 ? 57.628  13.228  100.507 1.00 30.35 ? 38   DA  F C6    1 
ATOM   769  N  N6    . DA  B 2 21 ? 58.482  12.223  100.686 1.00 27.70 ? 38   DA  F N6    1 
ATOM   770  N  N1    . DA  B 2 21 ? 58.097  14.451  100.188 1.00 29.31 ? 38   DA  F N1    1 
ATOM   771  C  C2    . DA  B 2 21 ? 57.245  15.460  100.071 1.00 29.91 ? 38   DA  F C2    1 
ATOM   772  N  N3    . DA  B 2 21 ? 55.921  15.458  100.227 1.00 30.90 ? 38   DA  F N3    1 
ATOM   773  C  C4    . DA  B 2 21 ? 55.479  14.217  100.553 1.00 30.84 ? 38   DA  F C4    1 
ATOM   774  O  "O5'" . DT  C 1 1  ? 64.627  14.968  95.261  1.00 47.22 ? 39   DT  G "O5'" 1 
ATOM   775  C  "C5'" . DT  C 1 1  ? 64.897  15.801  96.384  1.00 45.98 ? 39   DT  G "C5'" 1 
ATOM   776  C  "C4'" . DT  C 1 1  ? 63.964  17.006  96.442  1.00 46.58 ? 39   DT  G "C4'" 1 
ATOM   777  O  "O4'" . DT  C 1 1  ? 62.712  16.672  97.045  1.00 45.95 ? 39   DT  G "O4'" 1 
ATOM   778  C  "C3'" . DT  C 1 1  ? 64.527  18.079  97.351  1.00 51.66 ? 39   DT  G "C3'" 1 
ATOM   779  O  "O3'" . DT  C 1 1  ? 64.000  19.359  96.997  1.00 59.93 ? 39   DT  G "O3'" 1 
ATOM   780  C  "C2'" . DT  C 1 1  ? 64.019  17.650  98.738  1.00 44.29 ? 39   DT  G "C2'" 1 
ATOM   781  C  "C1'" . DT  C 1 1  ? 62.644  17.099  98.416  1.00 33.59 ? 39   DT  G "C1'" 1 
ATOM   782  N  N1    . DT  C 1 1  ? 62.318  15.907  99.205  1.00 29.75 ? 39   DT  G N1    1 
ATOM   783  C  C2    . DT  C 1 1  ? 60.998  15.758  99.550  1.00 30.24 ? 39   DT  G C2    1 
ATOM   784  O  O2    . DT  C 1 1  ? 60.205  16.695  99.486  1.00 29.31 ? 39   DT  G O2    1 
ATOM   785  N  N3    . DT  C 1 1  ? 60.643  14.518  100.059 1.00 28.96 ? 39   DT  G N3    1 
ATOM   786  C  C4    . DT  C 1 1  ? 61.496  13.441  100.272 1.00 28.80 ? 39   DT  G C4    1 
ATOM   787  O  O4    . DT  C 1 1  ? 61.093  12.398  100.784 1.00 28.32 ? 39   DT  G O4    1 
ATOM   788  C  C5    . DT  C 1 1  ? 62.862  13.701  99.900  1.00 28.39 ? 39   DT  G C5    1 
ATOM   789  C  C7    . DT  C 1 1  ? 63.881  12.573  100.056 1.00 28.93 ? 39   DT  G C7    1 
ATOM   790  C  C6    . DT  C 1 1  ? 63.227  14.895  99.393  1.00 28.76 ? 39   DT  G C6    1 
ATOM   791  P  P     . DT  C 1 2  ? 64.494  20.618  97.865  1.00 64.99 ? 40   DT  G P     1 
ATOM   792  O  OP1   . DT  C 1 2  ? 64.464  21.824  97.003  1.00 72.90 ? 40   DT  G OP1   1 
ATOM   793  O  OP2   . DT  C 1 2  ? 65.765  20.242  98.538  1.00 68.37 ? 40   DT  G OP2   1 
ATOM   794  O  "O5'" . DT  C 1 2  ? 63.295  20.711  98.976  1.00 67.53 ? 40   DT  G "O5'" 1 
ATOM   795  C  "C5'" . DT  C 1 2  ? 61.952  21.110  98.620  1.00 64.14 ? 40   DT  G "C5'" 1 
ATOM   796  C  "C4'" . DT  C 1 2  ? 60.907  21.182  99.782  1.00 60.95 ? 40   DT  G "C4'" 1 
ATOM   797  O  "O4'" . DT  C 1 2  ? 60.725  19.912  100.429 1.00 54.85 ? 40   DT  G "O4'" 1 
ATOM   798  C  "C3'" . DT  C 1 2  ? 61.242  22.165  100.935 1.00 62.63 ? 40   DT  G "C3'" 1 
ATOM   799  O  "O3'" . DT  C 1 2  ? 60.027  22.551  101.626 1.00 65.79 ? 40   DT  G "O3'" 1 
ATOM   800  C  "C2'" . DT  C 1 2  ? 62.043  21.240  101.848 1.00 48.64 ? 40   DT  G "C2'" 1 
ATOM   801  C  "C1'" . DT  C 1 2  ? 61.102  20.045  101.805 1.00 46.08 ? 40   DT  G "C1'" 1 
ATOM   802  N  N1    . DT  C 1 2  ? 61.674  18.777  102.268 1.00 37.22 ? 40   DT  G N1    1 
ATOM   803  C  C2    . DT  C 1 2  ? 60.751  17.855  102.682 1.00 36.02 ? 40   DT  G C2    1 
ATOM   804  O  O2    . DT  C 1 2  ? 59.560  18.148  102.779 1.00 36.27 ? 40   DT  G O2    1 
ATOM   805  N  N3    . DT  C 1 2  ? 61.238  16.601  102.981 1.00 35.02 ? 40   DT  G N3    1 
ATOM   806  C  C4    . DT  C 1 2  ? 62.552  16.201  102.899 1.00 36.53 ? 40   DT  G C4    1 
ATOM   807  O  O4    . DT  C 1 2  ? 62.868  15.033  103.119 1.00 37.34 ? 40   DT  G O4    1 
ATOM   808  C  C5    . DT  C 1 2  ? 63.446  17.242  102.473 1.00 35.32 ? 40   DT  G C5    1 
ATOM   809  C  C7    . DT  C 1 2  ? 64.927  16.927  102.356 1.00 35.65 ? 40   DT  G C7    1 
ATOM   810  C  C6    . DT  C 1 2  ? 62.996  18.472  102.176 1.00 36.12 ? 40   DT  G C6    1 
ATOM   811  P  P     . DG  C 1 3  ? 59.423  24.053  101.468 1.00 62.61 ? 41   DG  G P     1 
ATOM   812  O  OP1   . DG  C 1 3  ? 58.746  24.117  100.149 1.00 72.83 ? 41   DG  G OP1   1 
ATOM   813  O  OP2   . DG  C 1 3  ? 60.532  24.997  101.783 1.00 60.71 ? 41   DG  G OP2   1 
ATOM   814  O  "O5'" . DG  C 1 3  ? 58.252  24.200  102.582 1.00 65.81 ? 41   DG  G "O5'" 1 
ATOM   815  C  "C5'" . DG  C 1 3  ? 56.863  24.328  102.195 1.00 62.97 ? 41   DG  G "C5'" 1 
ATOM   816  C  "C4'" . DG  C 1 3  ? 55.856  24.129  103.360 1.00 54.89 ? 41   DG  G "C4'" 1 
ATOM   817  O  "O4'" . DG  C 1 3  ? 56.146  22.909  104.043 1.00 51.70 ? 41   DG  G "O4'" 1 
ATOM   818  C  "C3'" . DG  C 1 3  ? 55.984  25.233  104.436 1.00 57.13 ? 41   DG  G "C3'" 1 
ATOM   819  O  "O3'" . DG  C 1 3  ? 54.894  25.302  105.391 1.00 60.82 ? 41   DG  G "O3'" 1 
ATOM   820  C  "C2'" . DG  C 1 3  ? 57.256  24.745  105.133 1.00 47.15 ? 41   DG  G "C2'" 1 
ATOM   821  C  "C1'" . DG  C 1 3  ? 57.045  23.215  105.120 1.00 45.25 ? 41   DG  G "C1'" 1 
ATOM   822  N  N9    . DG  C 1 3  ? 58.322  22.461  105.003 1.00 35.19 ? 41   DG  G N9    1 
ATOM   823  C  C8    . DG  C 1 3  ? 59.597  22.922  104.766 1.00 33.89 ? 41   DG  G C8    1 
ATOM   824  N  N7    . DG  C 1 3  ? 60.526  22.018  104.958 1.00 32.90 ? 41   DG  G N7    1 
ATOM   825  C  C5    . DG  C 1 3  ? 59.822  20.874  105.343 1.00 30.09 ? 41   DG  G C5    1 
ATOM   826  C  C6    . DG  C 1 3  ? 60.300  19.570  105.668 1.00 29.82 ? 41   DG  G C6    1 
ATOM   827  O  O6    . DG  C 1 3  ? 61.467  19.167  105.754 1.00 28.66 ? 41   DG  G O6    1 
ATOM   828  N  N1    . DG  C 1 3  ? 59.248  18.718  105.943 1.00 27.49 ? 41   DG  G N1    1 
ATOM   829  C  C2    . DG  C 1 3  ? 57.916  19.077  105.937 1.00 29.63 ? 41   DG  G C2    1 
ATOM   830  N  N2    . DG  C 1 3  ? 57.040  18.134  106.271 1.00 29.45 ? 41   DG  G N2    1 
ATOM   831  N  N3    . DG  C 1 3  ? 57.467  20.296  105.652 1.00 28.70 ? 41   DG  G N3    1 
ATOM   832  C  C4    . DG  C 1 3  ? 58.477  21.137  105.359 1.00 31.28 ? 41   DG  G C4    1 
ATOM   833  P  P     . DC  C 1 4  ? 53.291  25.259  105.060 1.00 66.80 ? 42   DC  G P     1 
ATOM   834  O  OP1   . DC  C 1 4  ? 53.101  25.386  103.600 1.00 75.15 ? 42   DC  G OP1   1 
ATOM   835  O  OP2   . DC  C 1 4  ? 52.576  26.187  105.971 1.00 67.85 ? 42   DC  G OP2   1 
ATOM   836  O  "O5'" . DC  C 1 4  ? 52.867  23.759  105.466 1.00 71.30 ? 42   DC  G "O5'" 1 
ATOM   837  C  "C5'" . DC  C 1 4  ? 53.856  22.833  105.939 1.00 68.22 ? 42   DC  G "C5'" 1 
ATOM   838  C  "C4'" . DC  C 1 4  ? 53.440  22.162  107.244 1.00 59.67 ? 42   DC  G "C4'" 1 
ATOM   839  O  "O4'" . DC  C 1 4  ? 54.520  21.414  107.818 1.00 53.16 ? 42   DC  G "O4'" 1 
ATOM   840  C  "C3'" . DC  C 1 4  ? 53.076  23.199  108.291 1.00 60.04 ? 42   DC  G "C3'" 1 
ATOM   841  O  "O3'" . DC  C 1 4  ? 52.105  22.586  109.145 1.00 64.12 ? 42   DC  G "O3'" 1 
ATOM   842  C  "C2'" . DC  C 1 4  ? 54.430  23.490  108.951 1.00 44.12 ? 42   DC  G "C2'" 1 
ATOM   843  C  "C1'" . DC  C 1 4  ? 55.136  22.148  108.872 1.00 40.84 ? 42   DC  G "C1'" 1 
ATOM   844  N  N1    . DC  C 1 4  ? 56.573  22.312  108.594 1.00 34.11 ? 42   DC  G N1    1 
ATOM   845  C  C2    . DC  C 1 4  ? 57.395  21.194  108.736 1.00 32.85 ? 42   DC  G C2    1 
ATOM   846  O  O2    . DC  C 1 4  ? 56.909  20.091  108.996 1.00 36.42 ? 42   DC  G O2    1 
ATOM   847  N  N3    . DC  C 1 4  ? 58.736  21.340  108.582 1.00 31.70 ? 42   DC  G N3    1 
ATOM   848  C  C4    . DC  C 1 4  ? 59.248  22.538  108.289 1.00 32.41 ? 42   DC  G C4    1 
ATOM   849  N  N4    . DC  C 1 4  ? 60.558  22.659  108.065 1.00 30.52 ? 42   DC  G N4    1 
ATOM   850  C  C5    . DC  C 1 4  ? 58.409  23.692  108.142 1.00 31.74 ? 42   DC  G C5    1 
ATOM   851  C  C6    . DC  C 1 4  ? 57.081  23.527  108.302 1.00 32.06 ? 42   DC  G C6    1 
ATOM   852  P  P     . DA  C 1 5  ? 51.875  22.961  110.688 1.00 53.01 ? 43   DA  G P     1 
ATOM   853  O  OP1   . DA  C 1 5  ? 50.414  23.049  110.955 1.00 56.83 ? 43   DA  G OP1   1 
ATOM   854  O  OP2   . DA  C 1 5  ? 52.801  24.057  111.071 1.00 61.23 ? 43   DA  G OP2   1 
ATOM   855  O  "O5'" . DA  C 1 5  ? 52.405  21.610  111.333 1.00 60.36 ? 43   DA  G "O5'" 1 
ATOM   856  C  "C5'" . DA  C 1 5  ? 51.536  20.490  111.321 1.00 44.45 ? 43   DA  G "C5'" 1 
ATOM   857  C  "C4'" . DA  C 1 5  ? 52.101  19.419  112.208 1.00 37.96 ? 43   DA  G "C4'" 1 
ATOM   858  O  "O4'" . DA  C 1 5  ? 53.527  19.351  112.060 1.00 34.82 ? 43   DA  G "O4'" 1 
ATOM   859  C  "C3'" . DA  C 1 5  ? 51.840  19.746  113.651 1.00 34.55 ? 43   DA  G "C3'" 1 
ATOM   860  O  "O3'" . DA  C 1 5  ? 51.702  18.484  114.261 1.00 37.68 ? 43   DA  G "O3'" 1 
ATOM   861  C  "C2'" . DA  C 1 5  ? 53.109  20.482  114.073 1.00 31.42 ? 43   DA  G "C2'" 1 
ATOM   862  C  "C1'" . DA  C 1 5  ? 54.190  19.835  113.214 1.00 27.96 ? 43   DA  G "C1'" 1 
ATOM   863  N  N9    . DA  C 1 5  ? 55.180  20.839  112.797 1.00 24.69 ? 43   DA  G N9    1 
ATOM   864  C  C8    . DA  C 1 5  ? 54.978  22.176  112.538 1.00 24.38 ? 43   DA  G C8    1 
ATOM   865  N  N7    . DA  C 1 5  ? 56.078  22.825  112.236 1.00 25.08 ? 43   DA  G N7    1 
ATOM   866  C  C5    . DA  C 1 5  ? 57.072  21.853  112.301 1.00 22.69 ? 43   DA  G C5    1 
ATOM   867  C  C6    . DA  C 1 5  ? 58.447  21.913  112.081 1.00 25.90 ? 43   DA  G C6    1 
ATOM   868  N  N6    . DA  C 1 5  ? 59.071  23.080  111.921 1.00 25.08 ? 43   DA  G N6    1 
ATOM   869  N  N1    . DA  C 1 5  ? 59.148  20.774  112.186 1.00 20.72 ? 43   DA  G N1    1 
ATOM   870  C  C2    . DA  C 1 5  ? 58.506  19.669  112.529 1.00 22.31 ? 43   DA  G C2    1 
ATOM   871  N  N3    . DA  C 1 5  ? 57.213  19.482  112.788 1.00 24.16 ? 43   DA  G N3    1 
ATOM   872  C  C4    . DA  C 1 5  ? 56.540  20.640  112.639 1.00 22.99 ? 43   DA  G C4    1 
ATOM   873  P  P     . DG  C 1 6  ? 51.813  18.236  115.826 1.00 42.29 ? 44   DG  G P     1 
ATOM   874  O  OP1   . DG  C 1 6  ? 51.225  16.915  116.132 1.00 47.70 ? 44   DG  G OP1   1 
ATOM   875  O  OP2   . DG  C 1 6  ? 51.361  19.440  116.559 1.00 43.78 ? 44   DG  G OP2   1 
ATOM   876  O  "O5'" . DG  C 1 6  ? 53.391  18.091  115.938 1.00 35.40 ? 44   DG  G "O5'" 1 
ATOM   877  C  "C5'" . DG  C 1 6  ? 53.970  16.858  115.575 1.00 27.93 ? 44   DG  G "C5'" 1 
ATOM   878  C  "C4'" . DG  C 1 6  ? 55.340  16.734  116.174 1.00 28.96 ? 44   DG  G "C4'" 1 
ATOM   879  O  "O4'" . DG  C 1 6  ? 56.242  17.731  115.675 1.00 31.47 ? 44   DG  G "O4'" 1 
ATOM   880  C  "C3'" . DG  C 1 6  ? 55.299  16.935  117.681 1.00 31.35 ? 44   DG  G "C3'" 1 
ATOM   881  O  "O3'" . DG  C 1 6  ? 56.293  16.064  118.191 1.00 32.48 ? 44   DG  G "O3'" 1 
ATOM   882  C  "C2'" . DG  C 1 6  ? 55.772  18.387  117.838 1.00 28.42 ? 44   DG  G "C2'" 1 
ATOM   883  C  "C1'" . DG  C 1 6  ? 56.819  18.488  116.741 1.00 22.31 ? 44   DG  G "C1'" 1 
ATOM   884  N  N9    . DG  C 1 6  ? 57.001  19.876  116.306 1.00 19.98 ? 44   DG  G N9    1 
ATOM   885  C  C8    . DG  C 1 6  ? 56.048  20.841  116.131 1.00 20.15 ? 44   DG  G C8    1 
ATOM   886  N  N7    . DG  C 1 6  ? 56.535  21.989  115.735 1.00 20.79 ? 44   DG  G N7    1 
ATOM   887  C  C5    . DG  C 1 6  ? 57.905  21.764  115.630 1.00 18.56 ? 44   DG  G C5    1 
ATOM   888  C  C6    . DG  C 1 6  ? 58.949  22.642  115.221 1.00 23.06 ? 44   DG  G C6    1 
ATOM   889  O  O6    . DG  C 1 6  ? 58.861  23.813  114.857 1.00 24.90 ? 44   DG  G O6    1 
ATOM   890  N  N1    . DG  C 1 6  ? 60.193  22.024  115.260 1.00 19.59 ? 44   DG  G N1    1 
ATOM   891  C  C2    . DG  C 1 6  ? 60.401  20.722  115.641 1.00 17.79 ? 44   DG  G C2    1 
ATOM   892  N  N2    . DG  C 1 6  ? 61.664  20.310  115.658 1.00 17.91 ? 44   DG  G N2    1 
ATOM   893  N  N3    . DG  C 1 6  ? 59.420  19.890  116.013 1.00 18.72 ? 44   DG  G N3    1 
ATOM   894  C  C4    . DG  C 1 6  ? 58.201  20.476  115.984 1.00 18.96 ? 44   DG  G C4    1 
ATOM   895  P  P     . DT  C 1 7  ? 56.280  15.481  119.653 1.00 32.46 ? 45   DT  G P     1 
ATOM   896  O  OP1   . DT  C 1 7  ? 56.684  14.065  119.581 1.00 28.97 ? 45   DT  G OP1   1 
ATOM   897  O  OP2   . DT  C 1 7  ? 55.041  15.903  120.342 1.00 25.89 ? 45   DT  G OP2   1 
ATOM   898  O  "O5'" . DT  C 1 7  ? 57.514  16.302  120.188 1.00 30.60 ? 45   DT  G "O5'" 1 
ATOM   899  C  "C5'" . DT  C 1 7  ? 58.706  15.905  119.578 1.00 21.35 ? 45   DT  G "C5'" 1 
ATOM   900  C  "C4'" . DT  C 1 7  ? 59.855  16.811  119.882 1.00 23.93 ? 45   DT  G "C4'" 1 
ATOM   901  O  "O4'" . DT  C 1 7  ? 59.728  18.056  119.184 1.00 24.58 ? 45   DT  G "O4'" 1 
ATOM   902  C  "C3'" . DT  C 1 7  ? 59.913  17.164  121.329 1.00 26.76 ? 45   DT  G "C3'" 1 
ATOM   903  O  "O3'" . DT  C 1 7  ? 61.152  16.745  121.879 1.00 29.68 ? 45   DT  G "O3'" 1 
ATOM   904  C  "C2'" . DT  C 1 7  ? 59.856  18.709  121.324 1.00 26.75 ? 45   DT  G "C2'" 1 
ATOM   905  C  "C1'" . DT  C 1 7  ? 60.312  19.094  119.936 1.00 19.50 ? 45   DT  G "C1'" 1 
ATOM   906  N  N1    . DT  C 1 7  ? 59.798  20.401  119.473 1.00 19.53 ? 45   DT  G N1    1 
ATOM   907  C  C2    . DT  C 1 7  ? 60.708  21.353  119.026 1.00 18.77 ? 45   DT  G C2    1 
ATOM   908  O  O2    . DT  C 1 7  ? 61.907  21.128  118.876 1.00 19.99 ? 45   DT  G O2    1 
ATOM   909  N  N3    . DT  C 1 7  ? 60.192  22.584  118.693 1.00 18.00 ? 45   DT  G N3    1 
ATOM   910  C  C4    . DT  C 1 7  ? 58.864  22.948  118.751 1.00 19.42 ? 45   DT  G C4    1 
ATOM   911  O  O4    . DT  C 1 7  ? 58.491  24.033  118.303 1.00 22.08 ? 45   DT  G O4    1 
ATOM   912  C  C5    . DT  C 1 7  ? 57.994  21.900  119.233 1.00 18.05 ? 45   DT  G C5    1 
ATOM   913  C  C7    . DT  C 1 7  ? 56.504  22.206  119.435 1.00 18.12 ? 45   DT  G C7    1 
ATOM   914  C  C6    . DT  C 1 7  ? 58.472  20.687  119.563 1.00 17.62 ? 45   DT  G C6    1 
ATOM   915  P  P     . DG  C 1 8  ? 61.268  16.686  123.477 1.00 31.16 ? 46   DG  G P     1 
ATOM   916  O  OP1   . DG  C 1 8  ? 62.152  15.563  123.868 1.00 28.38 ? 46   DG  G OP1   1 
ATOM   917  O  OP2   . DG  C 1 8  ? 59.923  16.852  124.075 1.00 31.33 ? 46   DG  G OP2   1 
ATOM   918  O  "O5'" . DG  C 1 8  ? 62.069  18.051  123.619 1.00 31.20 ? 46   DG  G "O5'" 1 
ATOM   919  C  "C5'" . DG  C 1 8  ? 63.341  18.039  122.994 1.00 28.24 ? 46   DG  G "C5'" 1 
ATOM   920  C  "C4'" . DG  C 1 8  ? 64.072  19.332  123.160 1.00 28.37 ? 46   DG  G "C4'" 1 
ATOM   921  O  "O4'" . DG  C 1 8  ? 63.514  20.334  122.317 1.00 32.56 ? 46   DG  G "O4'" 1 
ATOM   922  C  "C3'" . DG  C 1 8  ? 63.982  19.867  124.563 1.00 26.19 ? 46   DG  G "C3'" 1 
ATOM   923  O  "O3'" . DG  C 1 8  ? 65.245  20.420  124.818 1.00 32.16 ? 46   DG  G "O3'" 1 
ATOM   924  C  "C2'" . DG  C 1 8  ? 62.986  21.004  124.435 1.00 25.54 ? 46   DG  G "C2'" 1 
ATOM   925  C  "C1'" . DG  C 1 8  ? 63.295  21.523  123.047 1.00 24.74 ? 46   DG  G "C1'" 1 
ATOM   926  N  N9    . DG  C 1 8  ? 62.152  22.211  122.467 1.00 21.67 ? 46   DG  G N9    1 
ATOM   927  C  C8    . DG  C 1 8  ? 60.826  21.893  122.589 1.00 21.76 ? 46   DG  G C8    1 
ATOM   928  N  N7    . DG  C 1 8  ? 60.026  22.824  122.137 1.00 22.05 ? 46   DG  G N7    1 
ATOM   929  C  C5    . DG  C 1 8  ? 60.889  23.821  121.670 1.00 22.00 ? 46   DG  G C5    1 
ATOM   930  C  C6    . DG  C 1 8  ? 60.595  25.095  121.095 1.00 22.38 ? 46   DG  G C6    1 
ATOM   931  O  O6    . DG  C 1 8  ? 59.503  25.608  120.858 1.00 21.87 ? 46   DG  G O6    1 
ATOM   932  N  N1    . DG  C 1 8  ? 61.743  25.790  120.790 1.00 20.69 ? 46   DG  G N1    1 
ATOM   933  C  C2    . DG  C 1 8  ? 63.018  25.310  120.985 1.00 22.50 ? 46   DG  G C2    1 
ATOM   934  N  N2    . DG  C 1 8  ? 63.994  26.109  120.558 1.00 23.10 ? 46   DG  G N2    1 
ATOM   935  N  N3    . DG  C 1 8  ? 63.306  24.113  121.527 1.00 21.65 ? 46   DG  G N3    1 
ATOM   936  C  C4    . DG  C 1 8  ? 62.192  23.437  121.854 1.00 20.81 ? 46   DG  G C4    1 
ATOM   937  P  P     . DG  C 1 9  ? 65.678  20.903  126.271 1.00 37.24 ? 47   DG  G P     1 
ATOM   938  O  OP1   . DG  C 1 9  ? 66.923  20.200  126.652 1.00 33.95 ? 47   DG  G OP1   1 
ATOM   939  O  OP2   . DG  C 1 9  ? 64.488  20.913  127.155 1.00 34.42 ? 47   DG  G OP2   1 
ATOM   940  O  "O5'" . DG  C 1 9  ? 66.054  22.402  125.869 1.00 39.14 ? 47   DG  G "O5'" 1 
ATOM   941  C  "C5'" . DG  C 1 9  ? 67.266  22.540  125.137 1.00 35.51 ? 47   DG  G "C5'" 1 
ATOM   942  C  "C4'" . DG  C 1 9  ? 67.590  23.977  124.846 1.00 31.52 ? 47   DG  G "C4'" 1 
ATOM   943  O  "O4'" . DG  C 1 9  ? 66.565  24.617  124.079 1.00 28.49 ? 47   DG  G "O4'" 1 
ATOM   944  C  "C3'" . DG  C 1 9  ? 67.651  24.683  126.160 1.00 33.69 ? 47   DG  G "C3'" 1 
ATOM   945  O  "O3'" . DG  C 1 9  ? 68.657  25.664  126.100 1.00 41.45 ? 47   DG  G "O3'" 1 
ATOM   946  C  "C2'" . DG  C 1 9  ? 66.286  25.336  126.278 1.00 30.72 ? 47   DG  G "C2'" 1 
ATOM   947  C  "C1'" . DG  C 1 9  ? 65.958  25.662  124.822 1.00 23.05 ? 47   DG  G "C1'" 1 
ATOM   948  N  N9    . DG  C 1 9  ? 64.505  25.601  124.649 1.00 20.72 ? 47   DG  G N9    1 
ATOM   949  C  C8    . DG  C 1 9  ? 63.655  24.603  125.031 1.00 18.65 ? 47   DG  G C8    1 
ATOM   950  N  N7    . DG  C 1 9  ? 62.399  24.874  124.798 1.00 19.90 ? 47   DG  G N7    1 
ATOM   951  C  C5    . DG  C 1 9  ? 62.427  26.135  124.213 1.00 16.65 ? 47   DG  G C5    1 
ATOM   952  C  C6    . DG  C 1 9  ? 61.374  26.930  123.723 1.00 21.55 ? 47   DG  G C6    1 
ATOM   953  O  O6    . DG  C 1 9  ? 60.177  26.691  123.726 1.00 24.67 ? 47   DG  G O6    1 
ATOM   954  N  N1    . DG  C 1 9  ? 61.811  28.120  123.209 1.00 20.07 ? 47   DG  G N1    1 
ATOM   955  C  C2    . DG  C 1 9  ? 63.120  28.514  123.180 1.00 19.30 ? 47   DG  G C2    1 
ATOM   956  N  N2    . DG  C 1 9  ? 63.340  29.765  122.780 1.00 19.71 ? 47   DG  G N2    1 
ATOM   957  N  N3    . DG  C 1 9  ? 64.131  27.766  123.624 1.00 20.06 ? 47   DG  G N3    1 
ATOM   958  C  C4    . DG  C 1 9  ? 63.708  26.590  124.126 1.00 18.03 ? 47   DG  G C4    1 
ATOM   959  P  P     . DG  C 1 10 ? 69.292  26.097  127.490 1.00 42.99 ? 48   DG  G P     1 
ATOM   960  O  OP1   . DG  C 1 10 ? 70.733  26.337  127.276 1.00 47.54 ? 48   DG  G OP1   1 
ATOM   961  O  OP2   . DG  C 1 10 ? 68.842  25.134  128.516 1.00 48.93 ? 48   DG  G OP2   1 
ATOM   962  O  "O5'" . DG  C 1 10 ? 68.551  27.496  127.698 1.00 37.59 ? 48   DG  G "O5'" 1 
ATOM   963  C  "C5'" . DG  C 1 10 ? 68.931  28.480  126.773 1.00 30.07 ? 48   DG  G "C5'" 1 
ATOM   964  C  "C4'" . DG  C 1 10 ? 67.962  29.611  126.725 1.00 31.56 ? 48   DG  G "C4'" 1 
ATOM   965  O  "O4'" . DG  C 1 10 ? 66.671  29.194  126.283 1.00 34.83 ? 48   DG  G "O4'" 1 
ATOM   966  C  "C3'" . DG  C 1 10 ? 67.748  30.237  128.081 1.00 35.14 ? 48   DG  G "C3'" 1 
ATOM   967  O  "O3'" . DG  C 1 10 ? 67.665  31.641  127.874 1.00 36.92 ? 48   DG  G "O3'" 1 
ATOM   968  C  "C2'" . DG  C 1 10 ? 66.345  29.754  128.449 1.00 31.39 ? 48   DG  G "C2'" 1 
ATOM   969  C  "C1'" . DG  C 1 10 ? 65.673  29.788  127.105 1.00 26.59 ? 48   DG  G "C1'" 1 
ATOM   970  N  N9    . DG  C 1 10 ? 64.419  29.032  127.071 1.00 24.37 ? 48   DG  G N9    1 
ATOM   971  C  C8    . DG  C 1 10 ? 64.174  27.765  127.514 1.00 25.31 ? 48   DG  G C8    1 
ATOM   972  N  N7    . DG  C 1 10 ? 62.918  27.407  127.419 1.00 27.10 ? 48   DG  G N7    1 
ATOM   973  C  C5    . DG  C 1 10 ? 62.295  28.518  126.863 1.00 24.49 ? 48   DG  G C5    1 
ATOM   974  C  C6    . DG  C 1 10 ? 60.936  28.719  126.523 1.00 25.38 ? 48   DG  G C6    1 
ATOM   975  O  O6    . DG  C 1 10 ? 60.016  27.911  126.562 1.00 27.84 ? 48   DG  G O6    1 
ATOM   976  N  N1    . DG  C 1 10 ? 60.717  29.976  125.997 1.00 27.53 ? 48   DG  G N1    1 
ATOM   977  C  C2    . DG  C 1 10 ? 61.703  30.913  125.805 1.00 26.74 ? 48   DG  G C2    1 
ATOM   978  N  N2    . DG  C 1 10 ? 61.318  32.063  125.265 1.00 28.19 ? 48   DG  G N2    1 
ATOM   979  N  N3    . DG  C 1 10 ? 62.988  30.719  126.114 1.00 25.28 ? 48   DG  G N3    1 
ATOM   980  C  C4    . DG  C 1 10 ? 63.207  29.508  126.641 1.00 24.94 ? 48   DG  G C4    1 
ATOM   981  P  P     . DG  C 1 11 ? 67.875  32.691  129.050 1.00 33.46 ? 49   DG  G P     1 
ATOM   982  O  OP1   . DG  C 1 11 ? 68.981  33.607  128.687 1.00 35.14 ? 49   DG  G OP1   1 
ATOM   983  O  OP2   . DG  C 1 11 ? 67.874  31.981  130.352 1.00 38.43 ? 49   DG  G OP2   1 
ATOM   984  O  "O5'" . DG  C 1 11 ? 66.491  33.431  128.834 1.00 30.83 ? 49   DG  G "O5'" 1 
ATOM   985  C  "C5'" . DG  C 1 11 ? 66.440  34.123  127.604 1.00 24.54 ? 49   DG  G "C5'" 1 
ATOM   986  C  "C4'" . DG  C 1 11 ? 65.194  34.922  127.482 1.00 26.79 ? 49   DG  G "C4'" 1 
ATOM   987  O  "O4'" . DG  C 1 11 ? 64.053  34.071  127.382 1.00 31.55 ? 49   DG  G "O4'" 1 
ATOM   988  C  "C3'" . DG  C 1 11 ? 64.992  35.766  128.710 1.00 30.50 ? 49   DG  G "C3'" 1 
ATOM   989  O  "O3'" . DG  C 1 11 ? 64.315  36.930  128.259 1.00 33.71 ? 49   DG  G "O3'" 1 
ATOM   990  C  "C2'" . DG  C 1 11 ? 64.073  34.872  129.549 1.00 29.64 ? 49   DG  G "C2'" 1 
ATOM   991  C  "C1'" . DG  C 1 11 ? 63.170  34.267  128.475 1.00 25.09 ? 49   DG  G "C1'" 1 
ATOM   992  N  N9    . DG  C 1 11 ? 62.607  32.961  128.861 1.00 23.24 ? 49   DG  G N9    1 
ATOM   993  C  C8    . DG  C 1 11 ? 63.257  31.864  129.369 1.00 23.31 ? 49   DG  G C8    1 
ATOM   994  N  N7    . DG  C 1 11 ? 62.463  30.840  129.552 1.00 23.04 ? 49   DG  G N7    1 
ATOM   995  C  C5    . DG  C 1 11 ? 61.206  31.290  129.138 1.00 21.61 ? 49   DG  G C5    1 
ATOM   996  C  C6    . DG  C 1 11 ? 59.953  30.619  129.106 1.00 21.96 ? 49   DG  G C6    1 
ATOM   997  O  O6    . DG  C 1 11 ? 59.694  29.466  129.434 1.00 24.58 ? 49   DG  G O6    1 
ATOM   998  N  N1    . DG  C 1 11 ? 58.935  31.425  128.648 1.00 23.64 ? 49   DG  G N1    1 
ATOM   999  C  C2    . DG  C 1 11 ? 59.096  32.729  128.262 1.00 21.81 ? 49   DG  G C2    1 
ATOM   1000 N  N2    . DG  C 1 11 ? 57.983  33.375  127.933 1.00 21.80 ? 49   DG  G N2    1 
ATOM   1001 N  N3    . DG  C 1 11 ? 60.274  33.364  128.270 1.00 21.36 ? 49   DG  G N3    1 
ATOM   1002 C  C4    . DG  C 1 11 ? 61.283  32.585  128.722 1.00 20.71 ? 49   DG  G C4    1 
ATOM   1003 P  P     . DT  C 1 12 ? 64.307  38.260  129.129 1.00 35.15 ? 50   DT  G P     1 
ATOM   1004 O  OP1   . DT  C 1 12 ? 64.485  39.405  128.214 1.00 36.90 ? 50   DT  G OP1   1 
ATOM   1005 O  OP2   . DT  C 1 12 ? 65.210  38.049  130.286 1.00 36.05 ? 50   DT  G OP2   1 
ATOM   1006 O  "O5'" . DT  C 1 12 ? 62.810  38.293  129.629 1.00 36.24 ? 50   DT  G "O5'" 1 
ATOM   1007 C  "C5'" . DT  C 1 12 ? 61.851  37.706  128.759 1.00 36.76 ? 50   DT  G "C5'" 1 
ATOM   1008 C  "C4'" . DT  C 1 12 ? 60.452  37.932  129.262 1.00 39.69 ? 50   DT  G "C4'" 1 
ATOM   1009 O  "O4'" . DT  C 1 12 ? 59.811  36.669  129.484 1.00 40.69 ? 50   DT  G "O4'" 1 
ATOM   1010 C  "C3'" . DT  C 1 12 ? 60.469  38.649  130.602 1.00 40.23 ? 50   DT  G "C3'" 1 
ATOM   1011 O  "O3'" . DT  C 1 12 ? 59.379  39.556  130.590 1.00 44.34 ? 50   DT  G "O3'" 1 
ATOM   1012 C  "C2'" . DT  C 1 12 ? 60.224  37.516  131.611 1.00 39.63 ? 50   DT  G "C2'" 1 
ATOM   1013 C  "C1'" . DT  C 1 12 ? 59.338  36.542  130.825 1.00 32.06 ? 50   DT  G "C1'" 1 
ATOM   1014 N  N1    . DT  C 1 12 ? 59.517  35.134  131.245 1.00 26.93 ? 50   DT  G N1    1 
ATOM   1015 C  C2    . DT  C 1 12 ? 58.412  34.308  131.259 1.00 26.75 ? 50   DT  G C2    1 
ATOM   1016 O  O2    . DT  C 1 12 ? 57.308  34.668  130.871 1.00 27.11 ? 50   DT  G O2    1 
ATOM   1017 N  N3    . DT  C 1 12 ? 58.617  33.029  131.731 1.00 27.51 ? 50   DT  G N3    1 
ATOM   1018 C  C4    . DT  C 1 12 ? 59.816  32.514  132.186 1.00 26.47 ? 50   DT  G C4    1 
ATOM   1019 O  O4    . DT  C 1 12 ? 59.899  31.359  132.582 1.00 29.75 ? 50   DT  G O4    1 
ATOM   1020 C  C5    . DT  C 1 12 ? 60.915  33.435  132.132 1.00 27.12 ? 50   DT  G C5    1 
ATOM   1021 C  C7    . DT  C 1 12 ? 62.270  32.998  132.684 1.00 26.18 ? 50   DT  G C7    1 
ATOM   1022 C  C6    . DT  C 1 12 ? 60.738  34.686  131.665 1.00 27.77 ? 50   DT  G C6    1 
ATOM   1023 P  P     . DG  C 1 13 ? 59.132  40.542  131.815 1.00 43.71 ? 51   DG  G P     1 
ATOM   1024 O  OP1   . DG  C 1 13 ? 59.071  41.924  131.298 1.00 46.21 ? 51   DG  G OP1   1 
ATOM   1025 O  OP2   . DG  C 1 13 ? 60.061  40.174  132.909 1.00 44.92 ? 51   DG  G OP2   1 
ATOM   1026 O  "O5'" . DG  C 1 13 ? 57.658  40.089  132.211 1.00 41.00 ? 51   DG  G "O5'" 1 
ATOM   1027 C  "C5'" . DG  C 1 13 ? 56.692  40.207  131.187 1.00 34.91 ? 51   DG  G "C5'" 1 
ATOM   1028 C  "C4'" . DG  C 1 13 ? 55.396  39.653  131.658 1.00 35.83 ? 51   DG  G "C4'" 1 
ATOM   1029 O  "O4'" . DG  C 1 13 ? 55.546  38.267  131.960 1.00 37.49 ? 51   DG  G "O4'" 1 
ATOM   1030 C  "C3'" . DG  C 1 13 ? 54.999  40.307  132.950 1.00 35.75 ? 51   DG  G "C3'" 1 
ATOM   1031 O  "O3'" . DG  C 1 13 ? 53.585  40.305  132.995 1.00 42.48 ? 51   DG  G "O3'" 1 
ATOM   1032 C  "C2'" . DG  C 1 13 ? 55.579  39.349  133.982 1.00 33.22 ? 51   DG  G "C2'" 1 
ATOM   1033 C  "C1'" . DG  C 1 13 ? 55.327  38.006  133.342 1.00 29.48 ? 51   DG  G "C1'" 1 
ATOM   1034 N  N9    . DG  C 1 13 ? 56.303  36.999  133.789 1.00 27.59 ? 51   DG  G N9    1 
ATOM   1035 C  C8    . DG  C 1 13 ? 57.631  37.174  134.027 1.00 26.45 ? 51   DG  G C8    1 
ATOM   1036 N  N7    . DG  C 1 13 ? 58.261  36.069  134.335 1.00 26.99 ? 51   DG  G N7    1 
ATOM   1037 C  C5    . DG  C 1 13 ? 57.275  35.093  134.303 1.00 23.76 ? 51   DG  G C5    1 
ATOM   1038 C  C6    . DG  C 1 13 ? 57.370  33.710  134.568 1.00 23.52 ? 51   DG  G C6    1 
ATOM   1039 O  O6    . DG  C 1 13 ? 58.363  33.087  134.911 1.00 22.58 ? 51   DG  G O6    1 
ATOM   1040 N  N1    . DG  C 1 13 ? 56.160  33.065  134.435 1.00 24.21 ? 51   DG  G N1    1 
ATOM   1041 C  C2    . DG  C 1 13 ? 54.976  33.688  134.086 1.00 24.98 ? 51   DG  G C2    1 
ATOM   1042 N  N2    . DG  C 1 13 ? 53.869  32.939  134.089 1.00 25.29 ? 51   DG  G N2    1 
ATOM   1043 N  N3    . DG  C 1 13 ? 54.885  35.000  133.829 1.00 26.55 ? 51   DG  G N3    1 
ATOM   1044 C  C4    . DG  C 1 13 ? 56.073  35.643  133.962 1.00 24.97 ? 51   DG  G C4    1 
ATOM   1045 P  P     . DA  C 1 14 ? 52.799  40.680  134.332 1.00 49.10 ? 52   DA  G P     1 
ATOM   1046 O  OP1   . DA  C 1 14 ? 51.649  41.534  133.959 1.00 48.20 ? 52   DA  G OP1   1 
ATOM   1047 O  OP2   . DA  C 1 14 ? 53.754  41.108  135.378 1.00 51.96 ? 52   DA  G OP2   1 
ATOM   1048 O  "O5'" . DA  C 1 14 ? 52.262  39.251  134.768 1.00 50.60 ? 52   DA  G "O5'" 1 
ATOM   1049 C  "C5'" . DA  C 1 14 ? 51.273  38.619  133.967 1.00 49.33 ? 52   DA  G "C5'" 1 
ATOM   1050 C  "C4'" . DA  C 1 14 ? 50.681  37.482  134.744 1.00 44.04 ? 52   DA  G "C4'" 1 
ATOM   1051 O  "O4'" . DA  C 1 14 ? 51.712  36.532  135.047 1.00 42.13 ? 52   DA  G "O4'" 1 
ATOM   1052 C  "C3'" . DA  C 1 14 ? 50.168  37.981  136.085 1.00 46.39 ? 52   DA  G "C3'" 1 
ATOM   1053 O  "O3'" . DA  C 1 14 ? 49.026  37.190  136.399 1.00 52.62 ? 52   DA  G "O3'" 1 
ATOM   1054 C  "C2'" . DA  C 1 14 ? 51.349  37.694  137.030 1.00 39.63 ? 52   DA  G "C2'" 1 
ATOM   1055 C  "C1'" . DA  C 1 14 ? 51.880  36.393  136.453 1.00 31.38 ? 52   DA  G "C1'" 1 
ATOM   1056 N  N9    . DA  C 1 14 ? 53.294  36.147  136.752 1.00 26.95 ? 52   DA  G N9    1 
ATOM   1057 C  C8    . DA  C 1 14 ? 54.307  37.042  136.880 1.00 25.39 ? 52   DA  G C8    1 
ATOM   1058 N  N7    . DA  C 1 14 ? 55.444  36.501  137.228 1.00 26.63 ? 52   DA  G N7    1 
ATOM   1059 C  C5    . DA  C 1 14 ? 55.162  35.142  137.326 1.00 25.23 ? 52   DA  G C5    1 
ATOM   1060 C  C6    . DA  C 1 14 ? 55.950  34.017  137.654 1.00 27.60 ? 52   DA  G C6    1 
ATOM   1061 N  N6    . DA  C 1 14 ? 57.265  34.087  137.860 1.00 27.63 ? 52   DA  G N6    1 
ATOM   1062 N  N1    . DA  C 1 14 ? 55.350  32.811  137.668 1.00 26.45 ? 52   DA  G N1    1 
ATOM   1063 C  C2    . DA  C 1 14 ? 54.061  32.735  137.356 1.00 26.55 ? 52   DA  G C2    1 
ATOM   1064 N  N3    . DA  C 1 14 ? 53.219  33.707  137.022 1.00 27.05 ? 52   DA  G N3    1 
ATOM   1065 C  C4    . DA  C 1 14 ? 53.848  34.913  137.032 1.00 26.06 ? 52   DA  G C4    1 
ATOM   1066 P  P     . DT  C 1 15 ? 48.089  37.465  137.671 1.00 52.55 ? 53   DT  G P     1 
ATOM   1067 O  OP1   . DT  C 1 15 ? 46.734  36.995  137.299 1.00 53.23 ? 53   DT  G OP1   1 
ATOM   1068 O  OP2   . DT  C 1 15 ? 48.311  38.848  138.156 1.00 61.66 ? 53   DT  G OP2   1 
ATOM   1069 O  "O5'" . DT  C 1 15 ? 48.715  36.466  138.754 1.00 48.83 ? 53   DT  G "O5'" 1 
ATOM   1070 C  "C5'" . DT  C 1 15 ? 48.821  35.141  138.283 1.00 43.09 ? 53   DT  G "C5'" 1 
ATOM   1071 C  "C4'" . DT  C 1 15 ? 49.414  34.176  139.265 1.00 39.84 ? 53   DT  G "C4'" 1 
ATOM   1072 O  "O4'" . DT  C 1 15 ? 50.835  34.205  139.187 1.00 39.91 ? 53   DT  G "O4'" 1 
ATOM   1073 C  "C3'" . DT  C 1 15 ? 49.020  34.416  140.704 1.00 38.37 ? 53   DT  G "C3'" 1 
ATOM   1074 O  "O3'" . DT  C 1 15 ? 48.685  33.148  141.243 1.00 44.38 ? 53   DT  G "O3'" 1 
ATOM   1075 C  "C2'" . DT  C 1 15 ? 50.344  34.861  141.330 1.00 36.27 ? 53   DT  G "C2'" 1 
ATOM   1076 C  "C1'" . DT  C 1 15 ? 51.372  34.109  140.496 1.00 31.94 ? 53   DT  G "C1'" 1 
ATOM   1077 N  N1    . DT  C 1 15 ? 52.716  34.713  140.520 1.00 29.13 ? 53   DT  G N1    1 
ATOM   1078 C  C2    . DT  C 1 15 ? 53.785  33.875  140.732 1.00 27.97 ? 53   DT  G C2    1 
ATOM   1079 O  O2    . DT  C 1 15 ? 53.681  32.654  140.734 1.00 30.27 ? 53   DT  G O2    1 
ATOM   1080 N  N3    . DT  C 1 15 ? 55.019  34.474  140.828 1.00 29.01 ? 53   DT  G N3    1 
ATOM   1081 C  C4    . DT  C 1 15 ? 55.282  35.815  140.709 1.00 29.30 ? 53   DT  G C4    1 
ATOM   1082 O  O4    . DT  C 1 15 ? 56.425  36.242  140.837 1.00 29.66 ? 53   DT  G O4    1 
ATOM   1083 C  C5    . DT  C 1 15 ? 54.120  36.613  140.458 1.00 27.15 ? 53   DT  G C5    1 
ATOM   1084 C  C7    . DT  C 1 15 ? 54.302  38.097  140.204 1.00 29.01 ? 53   DT  G C7    1 
ATOM   1085 C  C6    . DT  C 1 15 ? 52.893  36.060  140.379 1.00 29.10 ? 53   DT  G C6    1 
ATOM   1086 P  P     . DC  C 1 16 ? 48.017  32.960  142.683 1.00 46.31 ? 54   DC  G P     1 
ATOM   1087 O  OP1   . DC  C 1 16 ? 46.859  32.058  142.516 1.00 48.17 ? 54   DC  G OP1   1 
ATOM   1088 O  OP2   . DC  C 1 16 ? 47.868  34.270  143.354 1.00 44.60 ? 54   DC  G OP2   1 
ATOM   1089 O  "O5'" . DC  C 1 16 ? 49.196  32.158  143.377 1.00 42.29 ? 54   DC  G "O5'" 1 
ATOM   1090 C  "C5'" . DC  C 1 16 ? 49.523  30.996  142.660 1.00 35.87 ? 54   DC  G "C5'" 1 
ATOM   1091 C  "C4'" . DC  C 1 16 ? 50.633  30.246  143.313 1.00 38.26 ? 54   DC  G "C4'" 1 
ATOM   1092 O  "O4'" . DC  C 1 16 ? 51.848  30.983  143.203 1.00 41.20 ? 54   DC  G "O4'" 1 
ATOM   1093 C  "C3'" . DC  C 1 16 ? 50.397  30.057  144.779 1.00 37.55 ? 54   DC  G "C3'" 1 
ATOM   1094 O  "O3'" . DC  C 1 16 ? 50.834  28.736  145.065 1.00 40.88 ? 54   DC  G "O3'" 1 
ATOM   1095 C  "C2'" . DC  C 1 16 ? 51.319  31.112  145.417 1.00 35.61 ? 54   DC  G "C2'" 1 
ATOM   1096 C  "C1'" . DC  C 1 16 ? 52.493  31.153  144.456 1.00 30.86 ? 54   DC  G "C1'" 1 
ATOM   1097 N  N1    . DC  C 1 16 ? 53.244  32.431  144.374 1.00 28.94 ? 54   DC  G N1    1 
ATOM   1098 C  C2    . DC  C 1 16 ? 54.615  32.345  144.396 1.00 27.50 ? 54   DC  G C2    1 
ATOM   1099 O  O2    . DC  C 1 16 ? 55.152  31.259  144.582 1.00 28.95 ? 54   DC  G O2    1 
ATOM   1100 N  N3    . DC  C 1 16 ? 55.346  33.467  144.200 1.00 27.21 ? 54   DC  G N3    1 
ATOM   1101 C  C4    . DC  C 1 16 ? 54.752  34.652  143.993 1.00 27.31 ? 54   DC  G C4    1 
ATOM   1102 N  N4    . DC  C 1 16 ? 55.509  35.756  143.867 1.00 26.90 ? 54   DC  G N4    1 
ATOM   1103 C  C5    . DC  C 1 16 ? 53.323  34.758  143.961 1.00 26.43 ? 54   DC  G C5    1 
ATOM   1104 C  C6    . DC  C 1 16 ? 52.617  33.624  144.158 1.00 27.85 ? 54   DC  G C6    1 
ATOM   1105 P  P     . DT  C 1 17 ? 50.685  28.164  146.539 1.00 43.70 ? 55   DT  G P     1 
ATOM   1106 O  OP1   . DT  C 1 17 ? 50.620  26.690  146.455 1.00 44.70 ? 55   DT  G OP1   1 
ATOM   1107 O  OP2   . DT  C 1 17 ? 49.648  28.937  147.265 1.00 43.92 ? 55   DT  G OP2   1 
ATOM   1108 O  "O5'" . DT  C 1 17 ? 52.108  28.588  147.088 1.00 41.73 ? 55   DT  G "O5'" 1 
ATOM   1109 C  "C5'" . DT  C 1 17 ? 53.231  28.092  146.392 1.00 39.49 ? 55   DT  G "C5'" 1 
ATOM   1110 C  "C4'" . DT  C 1 17 ? 54.459  28.198  147.244 1.00 42.55 ? 55   DT  G "C4'" 1 
ATOM   1111 O  "O4'" . DT  C 1 17 ? 54.995  29.510  147.087 1.00 41.13 ? 55   DT  G "O4'" 1 
ATOM   1112 C  "C3'" . DT  C 1 17 ? 54.150  28.025  148.738 1.00 44.40 ? 55   DT  G "C3'" 1 
ATOM   1113 O  "O3'" . DT  C 1 17 ? 55.285  27.424  149.382 1.00 48.55 ? 55   DT  G "O3'" 1 
ATOM   1114 C  "C2'" . DT  C 1 17 ? 53.976  29.485  149.186 1.00 40.51 ? 55   DT  G "C2'" 1 
ATOM   1115 C  "C1'" . DT  C 1 17 ? 55.057  30.158  148.348 1.00 34.01 ? 55   DT  G "C1'" 1 
ATOM   1116 N  N1    . DT  C 1 17 ? 54.922  31.605  148.121 1.00 29.13 ? 55   DT  G N1    1 
ATOM   1117 C  C2    . DT  C 1 17 ? 56.105  32.285  148.018 1.00 26.95 ? 55   DT  G C2    1 
ATOM   1118 O  O2    . DT  C 1 17 ? 57.179  31.737  148.244 1.00 29.34 ? 55   DT  G O2    1 
ATOM   1119 N  N3    . DT  C 1 17 ? 56.013  33.611  147.696 1.00 26.78 ? 55   DT  G N3    1 
ATOM   1120 C  C4    . DT  C 1 17 ? 54.851  34.306  147.482 1.00 27.69 ? 55   DT  G C4    1 
ATOM   1121 O  O4    . DT  C 1 17 ? 54.876  35.512  147.264 1.00 28.76 ? 55   DT  G O4    1 
ATOM   1122 C  C5    . DT  C 1 17 ? 53.657  33.525  147.614 1.00 25.32 ? 55   DT  G C5    1 
ATOM   1123 C  C7    . DT  C 1 17 ? 52.306  34.217  147.456 1.00 25.40 ? 55   DT  G C7    1 
ATOM   1124 C  C6    . DT  C 1 17 ? 53.724  32.220  147.923 1.00 28.13 ? 55   DT  G C6    1 
ATOM   1125 O  "O5'" . DC  D 2 1  ? 54.537  29.603  152.811 1.00 61.91 ? 56   DC  H "O5'" 1 
ATOM   1126 C  "C5'" . DC  D 2 1  ? 55.485  28.568  152.514 1.00 54.72 ? 56   DC  H "C5'" 1 
ATOM   1127 C  "C4'" . DC  D 2 1  ? 56.942  29.050  152.535 1.00 54.55 ? 56   DC  H "C4'" 1 
ATOM   1128 O  "O4'" . DC  D 2 1  ? 57.241  29.949  151.452 1.00 49.76 ? 56   DC  H "O4'" 1 
ATOM   1129 C  "C3'" . DC  D 2 1  ? 57.170  29.824  153.818 1.00 56.01 ? 56   DC  H "C3'" 1 
ATOM   1130 O  "O3'" . DC  D 2 1  ? 58.487  29.743  154.364 1.00 63.68 ? 56   DC  H "O3'" 1 
ATOM   1131 C  "C2'" . DC  D 2 1  ? 56.988  31.241  153.349 1.00 51.01 ? 56   DC  H "C2'" 1 
ATOM   1132 C  "C1'" . DC  D 2 1  ? 57.606  31.224  151.962 1.00 40.88 ? 56   DC  H "C1'" 1 
ATOM   1133 N  N1    . DC  D 2 1  ? 56.930  32.335  151.292 1.00 35.71 ? 56   DC  H N1    1 
ATOM   1134 C  C2    . DC  D 2 1  ? 57.676  33.474  151.030 1.00 35.53 ? 56   DC  H C2    1 
ATOM   1135 O  O2    . DC  D 2 1  ? 58.907  33.425  151.031 1.00 34.19 ? 56   DC  H O2    1 
ATOM   1136 N  N3    . DC  D 2 1  ? 57.012  34.631  150.771 1.00 34.33 ? 56   DC  H N3    1 
ATOM   1137 C  C4    . DC  D 2 1  ? 55.675  34.658  150.756 1.00 35.21 ? 56   DC  H C4    1 
ATOM   1138 N  N4    . DC  D 2 1  ? 55.042  35.787  150.456 1.00 35.91 ? 56   DC  H N4    1 
ATOM   1139 C  C5    . DC  D 2 1  ? 54.898  33.488  151.007 1.00 34.85 ? 56   DC  H C5    1 
ATOM   1140 C  C6    . DC  D 2 1  ? 55.575  32.353  151.261 1.00 35.07 ? 56   DC  H C6    1 
ATOM   1141 P  P     . DA  D 2 2  ? 58.679  30.267  155.895 1.00 58.46 ? 57   DA  H P     1 
ATOM   1142 O  OP1   . DA  D 2 2  ? 59.452  29.235  156.629 1.00 61.53 ? 57   DA  H OP1   1 
ATOM   1143 O  OP2   . DA  D 2 2  ? 57.378  30.753  156.420 1.00 53.48 ? 57   DA  H OP2   1 
ATOM   1144 O  "O5'" . DA  D 2 2  ? 59.609  31.540  155.661 1.00 55.98 ? 57   DA  H "O5'" 1 
ATOM   1145 C  "C5'" . DA  D 2 2  ? 60.893  31.334  155.092 1.00 50.61 ? 57   DA  H "C5'" 1 
ATOM   1146 C  "C4'" . DA  D 2 2  ? 61.627  32.636  155.111 1.00 47.75 ? 57   DA  H "C4'" 1 
ATOM   1147 O  "O4'" . DA  D 2 2  ? 60.983  33.528  154.199 1.00 42.09 ? 57   DA  H "O4'" 1 
ATOM   1148 C  "C3'" . DA  D 2 2  ? 61.490  33.262  156.502 1.00 53.42 ? 57   DA  H "C3'" 1 
ATOM   1149 O  "O3'" . DA  D 2 2  ? 62.593  34.111  156.849 1.00 69.25 ? 57   DA  H "O3'" 1 
ATOM   1150 C  "C2'" . DA  D 2 2  ? 60.257  34.120  156.323 1.00 42.54 ? 57   DA  H "C2'" 1 
ATOM   1151 C  "C1'" . DA  D 2 2  ? 60.452  34.625  154.916 1.00 31.68 ? 57   DA  H "C1'" 1 
ATOM   1152 N  N9    . DA  D 2 2  ? 59.165  35.021  154.387 1.00 24.11 ? 57   DA  H N9    1 
ATOM   1153 C  C8    . DA  D 2 2  ? 57.973  34.338  154.394 1.00 24.12 ? 57   DA  H C8    1 
ATOM   1154 N  N7    . DA  D 2 2  ? 56.958  35.067  153.996 1.00 23.82 ? 57   DA  H N7    1 
ATOM   1155 C  C5    . DA  D 2 2  ? 57.528  36.304  153.704 1.00 22.10 ? 57   DA  H C5    1 
ATOM   1156 C  C6    . DA  D 2 2  ? 56.987  37.510  153.258 1.00 23.15 ? 57   DA  H C6    1 
ATOM   1157 N  N6    . DA  D 2 2  ? 55.695  37.648  152.969 1.00 24.80 ? 57   DA  H N6    1 
ATOM   1158 N  N1    . DA  D 2 2  ? 57.827  38.548  153.116 1.00 23.26 ? 57   DA  H N1    1 
ATOM   1159 C  C2    . DA  D 2 2  ? 59.119  38.390  153.392 1.00 23.03 ? 57   DA  H C2    1 
ATOM   1160 N  N3    . DA  D 2 2  ? 59.758  37.301  153.811 1.00 21.89 ? 57   DA  H N3    1 
ATOM   1161 C  C4    . DA  D 2 2  ? 58.875  36.282  153.944 1.00 24.28 ? 57   DA  H C4    1 
ATOM   1162 P  P     . DT  D 2 3  ? 63.272  34.022  158.316 1.00 61.35 ? 58   DT  H P     1 
ATOM   1163 O  OP1   . DT  D 2 3  ? 64.409  34.976  158.344 1.00 74.78 ? 58   DT  H OP1   1 
ATOM   1164 O  OP2   . DT  D 2 3  ? 63.505  32.587  158.633 1.00 74.45 ? 58   DT  H OP2   1 
ATOM   1165 O  "O5'" . DT  D 2 3  ? 62.092  34.574  159.278 1.00 60.91 ? 58   DT  H "O5'" 1 
ATOM   1166 C  "C5'" . DT  D 2 3  ? 61.489  35.836  159.033 1.00 50.70 ? 58   DT  H "C5'" 1 
ATOM   1167 C  "C4'" . DT  D 2 3  ? 62.482  36.888  158.527 1.00 45.82 ? 58   DT  H "C4'" 1 
ATOM   1168 O  "O4'" . DT  D 2 3  ? 62.005  37.512  157.343 1.00 42.02 ? 58   DT  H "O4'" 1 
ATOM   1169 C  "C3'" . DT  D 2 3  ? 62.543  38.027  159.526 1.00 48.72 ? 58   DT  H "C3'" 1 
ATOM   1170 O  "O3'" . DT  D 2 3  ? 63.623  38.947  159.341 1.00 53.14 ? 58   DT  H "O3'" 1 
ATOM   1171 C  "C2'" . DT  D 2 3  ? 61.247  38.740  159.209 1.00 45.63 ? 58   DT  H "C2'" 1 
ATOM   1172 C  "C1'" . DT  D 2 3  ? 61.198  38.651  157.697 1.00 36.69 ? 58   DT  H "C1'" 1 
ATOM   1173 N  N1    . DT  D 2 3  ? 59.782  38.455  157.351 1.00 29.33 ? 58   DT  H N1    1 
ATOM   1174 C  C2    . DT  D 2 3  ? 59.122  39.479  156.718 1.00 29.39 ? 58   DT  H C2    1 
ATOM   1175 O  O2    . DT  D 2 3  ? 59.609  40.586  156.518 1.00 30.37 ? 58   DT  H O2    1 
ATOM   1176 N  N3    . DT  D 2 3  ? 57.829  39.221  156.384 1.00 26.81 ? 58   DT  H N3    1 
ATOM   1177 C  C4    . DT  D 2 3  ? 57.130  38.066  156.627 1.00 26.59 ? 58   DT  H C4    1 
ATOM   1178 O  O4    . DT  D 2 3  ? 55.955  37.984  156.268 1.00 29.27 ? 58   DT  H O4    1 
ATOM   1179 C  C5    . DT  D 2 3  ? 57.897  37.052  157.306 1.00 26.53 ? 58   DT  H C5    1 
ATOM   1180 C  C7    . DT  D 2 3  ? 57.294  35.688  157.624 1.00 25.58 ? 58   DT  H C7    1 
ATOM   1181 C  C6    . DT  D 2 3  ? 59.167  37.276  157.638 1.00 26.88 ? 58   DT  H C6    1 
ATOM   1182 P  P     . DG  D 2 4  ? 63.812  40.056  160.504 1.00 57.28 ? 59   DG  H P     1 
ATOM   1183 O  OP1   . DG  D 2 4  ? 65.051  40.815  160.233 1.00 62.06 ? 59   DG  H OP1   1 
ATOM   1184 O  OP2   . DG  D 2 4  ? 63.602  39.370  161.804 1.00 55.07 ? 59   DG  H OP2   1 
ATOM   1185 O  "O5'" . DG  D 2 4  ? 62.630  41.085  160.298 1.00 49.26 ? 59   DG  H "O5'" 1 
ATOM   1186 C  "C5'" . DG  D 2 4  ? 62.851  42.084  159.331 1.00 44.19 ? 59   DG  H "C5'" 1 
ATOM   1187 C  "C4'" . DG  D 2 4  ? 61.773  43.112  159.437 1.00 43.80 ? 59   DG  H "C4'" 1 
ATOM   1188 O  "O4'" . DG  D 2 4  ? 60.528  42.591  158.948 1.00 43.10 ? 59   DG  H "O4'" 1 
ATOM   1189 C  "C3'" . DG  D 2 4  ? 61.535  43.434  160.899 1.00 43.35 ? 59   DG  H "C3'" 1 
ATOM   1190 O  "O3'" . DG  D 2 4  ? 61.313  44.838  160.989 1.00 49.04 ? 59   DG  H "O3'" 1 
ATOM   1191 C  "C2'" . DG  D 2 4  ? 60.249  42.652  161.219 1.00 36.04 ? 59   DG  H "C2'" 1 
ATOM   1192 C  "C1'" . DG  D 2 4  ? 59.494  42.759  159.913 1.00 30.44 ? 59   DG  H "C1'" 1 
ATOM   1193 N  N9    . DG  D 2 4  ? 58.469  41.724  159.722 1.00 25.31 ? 59   DG  H N9    1 
ATOM   1194 C  C8    . DG  D 2 4  ? 58.545  40.377  159.963 1.00 25.51 ? 59   DG  H C8    1 
ATOM   1195 N  N7    . DG  D 2 4  ? 57.462  39.716  159.638 1.00 25.04 ? 59   DG  H N7    1 
ATOM   1196 C  C5    . DG  D 2 4  ? 56.603  40.704  159.150 1.00 21.48 ? 59   DG  H C5    1 
ATOM   1197 C  C6    . DG  D 2 4  ? 55.280  40.592  158.659 1.00 25.65 ? 59   DG  H C6    1 
ATOM   1198 O  O6    . DG  D 2 4  ? 54.570  39.591  158.571 1.00 24.74 ? 59   DG  H O6    1 
ATOM   1199 N  N1    . DG  D 2 4  ? 54.778  41.814  158.267 1.00 21.99 ? 59   DG  H N1    1 
ATOM   1200 C  C2    . DG  D 2 4  ? 55.452  43.005  158.346 1.00 22.09 ? 59   DG  H C2    1 
ATOM   1201 N  N2    . DG  D 2 4  ? 54.758  44.072  157.977 1.00 21.75 ? 59   DG  H N2    1 
ATOM   1202 N  N3    . DG  D 2 4  ? 56.703  43.130  158.809 1.00 24.00 ? 59   DG  H N3    1 
ATOM   1203 C  C4    . DG  D 2 4  ? 57.213  41.932  159.194 1.00 20.85 ? 59   DG  H C4    1 
ATOM   1204 P  P     . DA  D 2 5  ? 61.393  45.576  162.411 1.00 51.80 ? 60   DA  H P     1 
ATOM   1205 O  OP1   . DA  D 2 5  ? 62.205  46.813  162.279 1.00 49.60 ? 60   DA  H OP1   1 
ATOM   1206 O  OP2   . DA  D 2 5  ? 61.707  44.552  163.436 1.00 46.60 ? 60   DA  H OP2   1 
ATOM   1207 O  "O5'" . DA  D 2 5  ? 59.860  46.009  162.547 1.00 45.65 ? 60   DA  H "O5'" 1 
ATOM   1208 C  "C5'" . DA  D 2 5  ? 59.281  46.807  161.516 1.00 40.14 ? 60   DA  H "C5'" 1 
ATOM   1209 C  "C4'" . DA  D 2 5  ? 57.818  47.041  161.802 1.00 41.79 ? 60   DA  H "C4'" 1 
ATOM   1210 O  "O4'" . DA  D 2 5  ? 56.954  46.026  161.255 1.00 36.33 ? 60   DA  H "O4'" 1 
ATOM   1211 C  "C3'" . DA  D 2 5  ? 57.634  46.976  163.321 1.00 42.72 ? 60   DA  H "C3'" 1 
ATOM   1212 O  "O3'" . DA  D 2 5  ? 56.525  47.784  163.677 1.00 48.83 ? 60   DA  H "O3'" 1 
ATOM   1213 C  "C2'" . DA  D 2 5  ? 57.255  45.523  163.525 1.00 35.42 ? 60   DA  H "C2'" 1 
ATOM   1214 C  "C1'" . DA  D 2 5  ? 56.312  45.393  162.349 1.00 29.42 ? 60   DA  H "C1'" 1 
ATOM   1215 N  N9    . DA  D 2 5  ? 56.002  44.004  162.103 1.00 23.86 ? 60   DA  H N9    1 
ATOM   1216 C  C8    . DA  D 2 5  ? 56.639  42.887  162.572 1.00 22.22 ? 60   DA  H C8    1 
ATOM   1217 N  N7    . DA  D 2 5  ? 55.954  41.788  162.405 1.00 22.30 ? 60   DA  H N7    1 
ATOM   1218 C  C5    . DA  D 2 5  ? 54.787  42.225  161.767 1.00 22.96 ? 60   DA  H C5    1 
ATOM   1219 C  C6    . DA  D 2 5  ? 53.639  41.558  161.345 1.00 22.32 ? 60   DA  H C6    1 
ATOM   1220 N  N6    . DA  D 2 5  ? 53.473  40.254  161.546 1.00 25.08 ? 60   DA  H N6    1 
ATOM   1221 N  N1    . DA  D 2 5  ? 52.668  42.290  160.781 1.00 23.72 ? 60   DA  H N1    1 
ATOM   1222 C  C2    . DA  D 2 5  ? 52.819  43.603  160.644 1.00 22.09 ? 60   DA  H C2    1 
ATOM   1223 N  N3    . DA  D 2 5  ? 53.847  44.346  161.005 1.00 21.64 ? 60   DA  H N3    1 
ATOM   1224 C  C4    . DA  D 2 5  ? 54.811  43.575  161.572 1.00 24.27 ? 60   DA  H C4    1 
ATOM   1225 P  P     . DG  D 2 6  ? 56.737  49.001  164.675 1.00 46.85 ? 61   DG  H P     1 
ATOM   1226 O  OP1   . DG  D 2 6  ? 57.559  50.027  163.989 1.00 51.15 ? 61   DG  H OP1   1 
ATOM   1227 O  OP2   . DG  D 2 6  ? 57.134  48.434  165.989 1.00 44.53 ? 61   DG  H OP2   1 
ATOM   1228 O  "O5'" . DG  D 2 6  ? 55.243  49.537  164.737 1.00 45.67 ? 61   DG  H "O5'" 1 
ATOM   1229 C  "C5'" . DG  D 2 6  ? 54.704  50.035  163.515 1.00 39.02 ? 61   DG  H "C5'" 1 
ATOM   1230 C  "C4'" . DG  D 2 6  ? 53.273  49.590  163.288 1.00 31.39 ? 61   DG  H "C4'" 1 
ATOM   1231 O  "O4'" . DG  D 2 6  ? 53.212  48.183  163.030 1.00 33.21 ? 61   DG  H "O4'" 1 
ATOM   1232 C  "C3'" . DG  D 2 6  ? 52.410  49.805  164.525 1.00 29.44 ? 61   DG  H "C3'" 1 
ATOM   1233 O  "O3'" . DG  D 2 6  ? 51.131  50.179  164.070 1.00 32.40 ? 61   DG  H "O3'" 1 
ATOM   1234 C  "C2'" . DG  D 2 6  ? 52.314  48.412  165.133 1.00 28.48 ? 61   DG  H "C2'" 1 
ATOM   1235 C  "C1'" . DG  D 2 6  ? 52.267  47.560  163.888 1.00 18.70 ? 61   DG  H "C1'" 1 
ATOM   1236 N  N9    . DG  D 2 6  ? 52.681  46.192  164.158 1.00 17.55 ? 61   DG  H N9    1 
ATOM   1237 C  C8    . DG  D 2 6  ? 53.822  45.734  164.743 1.00 17.14 ? 61   DG  H C8    1 
ATOM   1238 N  N7    . DG  D 2 6  ? 53.867  44.425  164.860 1.00 19.56 ? 61   DG  H N7    1 
ATOM   1239 C  C5    . DG  D 2 6  ? 52.662  43.996  164.313 1.00 14.84 ? 61   DG  H C5    1 
ATOM   1240 C  C6    . DG  D 2 6  ? 52.130  42.687  164.195 1.00 19.77 ? 61   DG  H C6    1 
ATOM   1241 O  O6    . DG  D 2 6  ? 52.653  41.616  164.492 1.00 21.86 ? 61   DG  H O6    1 
ATOM   1242 N  N1    . DG  D 2 6  ? 50.878  42.699  163.619 1.00 19.52 ? 61   DG  H N1    1 
ATOM   1243 C  C2    . DG  D 2 6  ? 50.219  43.837  163.199 1.00 20.48 ? 61   DG  H C2    1 
ATOM   1244 N  N2    . DG  D 2 6  ? 48.994  43.663  162.699 1.00 21.18 ? 61   DG  H N2    1 
ATOM   1245 N  N3    . DG  D 2 6  ? 50.722  45.071  163.303 1.00 17.41 ? 61   DG  H N3    1 
ATOM   1246 C  C4    . DG  D 2 6  ? 51.940  45.070  163.874 1.00 17.94 ? 61   DG  H C4    1 
ATOM   1247 P  P     . DA  D 2 7  ? 50.002  50.642  165.070 1.00 35.72 ? 62   DA  H P     1 
ATOM   1248 O  OP1   . DA  D 2 7  ? 49.218  51.727  164.449 1.00 30.66 ? 62   DA  H OP1   1 
ATOM   1249 O  OP2   . DA  D 2 7  ? 50.579  50.801  166.416 1.00 38.94 ? 62   DA  H OP2   1 
ATOM   1250 O  "O5'" . DA  D 2 7  ? 49.161  49.313  165.031 1.00 31.46 ? 62   DA  H "O5'" 1 
ATOM   1251 C  "C5'" . DA  D 2 7  ? 48.447  49.117  163.836 1.00 25.04 ? 62   DA  H "C5'" 1 
ATOM   1252 C  "C4'" . DA  D 2 7  ? 47.369  48.093  164.018 1.00 25.01 ? 62   DA  H "C4'" 1 
ATOM   1253 O  "O4'" . DA  D 2 7  ? 47.917  46.802  164.260 1.00 25.66 ? 62   DA  H "O4'" 1 
ATOM   1254 C  "C3'" . DA  D 2 7  ? 46.489  48.407  165.207 1.00 26.93 ? 62   DA  H "C3'" 1 
ATOM   1255 O  "O3'" . DA  D 2 7  ? 45.240  47.872  164.844 1.00 30.45 ? 62   DA  H "O3'" 1 
ATOM   1256 C  "C2'" . DA  D 2 7  ? 47.119  47.568  166.307 1.00 25.67 ? 62   DA  H "C2'" 1 
ATOM   1257 C  "C1'" . DA  D 2 7  ? 47.511  46.322  165.527 1.00 18.79 ? 62   DA  H "C1'" 1 
ATOM   1258 N  N9    . DA  D 2 7  ? 48.677  45.670  166.093 1.00 15.99 ? 62   DA  H N9    1 
ATOM   1259 C  C8    . DA  D 2 7  ? 49.843  46.221  166.569 1.00 15.51 ? 62   DA  H C8    1 
ATOM   1260 N  N7    . DA  D 2 7  ? 50.710  45.325  166.978 1.00 15.07 ? 62   DA  H N7    1 
ATOM   1261 C  C5    . DA  D 2 7  ? 50.064  44.099  166.763 1.00 18.63 ? 62   DA  H C5    1 
ATOM   1262 C  C6    . DA  D 2 7  ? 50.435  42.770  167.006 1.00 17.61 ? 62   DA  H C6    1 
ATOM   1263 N  N6    . DA  D 2 7  ? 51.634  42.412  167.459 1.00 17.01 ? 62   DA  H N6    1 
ATOM   1264 N  N1    . DA  D 2 7  ? 49.540  41.823  166.698 1.00 16.60 ? 62   DA  H N1    1 
ATOM   1265 C  C2    . DA  D 2 7  ? 48.372  42.169  166.173 1.00 17.09 ? 62   DA  H C2    1 
ATOM   1266 N  N3    . DA  D 2 7  ? 47.909  43.381  165.889 1.00 15.47 ? 62   DA  H N3    1 
ATOM   1267 C  C4    . DA  D 2 7  ? 48.826  44.310  166.221 1.00 17.40 ? 62   DA  H C4    1 
ATOM   1268 P  P     . DT  D 2 8  ? 43.896  48.260  165.552 1.00 29.32 ? 63   DT  H P     1 
ATOM   1269 O  OP1   . DT  D 2 8  ? 42.837  48.303  164.527 1.00 25.29 ? 63   DT  H OP1   1 
ATOM   1270 O  OP2   . DT  D 2 8  ? 44.131  49.398  166.472 1.00 26.28 ? 63   DT  H OP2   1 
ATOM   1271 O  "O5'" . DT  D 2 8  ? 43.749  46.913  166.373 1.00 23.92 ? 63   DT  H "O5'" 1 
ATOM   1272 C  "C5'" . DT  D 2 8  ? 43.342  45.833  165.593 1.00 16.52 ? 63   DT  H "C5'" 1 
ATOM   1273 C  "C4'" . DT  D 2 8  ? 43.192  44.590  166.393 1.00 19.88 ? 63   DT  H "C4'" 1 
ATOM   1274 O  "O4'" . DT  D 2 8  ? 44.470  44.054  166.730 1.00 20.53 ? 63   DT  H "O4'" 1 
ATOM   1275 C  "C3'" . DT  D 2 8  ? 42.483  44.854  167.690 1.00 25.50 ? 63   DT  H "C3'" 1 
ATOM   1276 O  "O3'" . DT  D 2 8  ? 41.428  43.925  167.863 1.00 27.22 ? 63   DT  H "O3'" 1 
ATOM   1277 C  "C2'" . DT  D 2 8  ? 43.559  44.530  168.731 1.00 26.52 ? 63   DT  H "C2'" 1 
ATOM   1278 C  "C1'" . DT  D 2 8  ? 44.448  43.515  168.037 1.00 18.83 ? 63   DT  H "C1'" 1 
ATOM   1279 N  N1    . DT  D 2 8  ? 45.812  43.491  168.599 1.00 21.68 ? 63   DT  H N1    1 
ATOM   1280 C  C2    . DT  D 2 8  ? 46.417  42.264  168.860 1.00 20.97 ? 63   DT  H C2    1 
ATOM   1281 O  O2    . DT  D 2 8  ? 45.881  41.171  168.675 1.00 22.86 ? 63   DT  H O2    1 
ATOM   1282 N  N3    . DT  D 2 8  ? 47.692  42.336  169.391 1.00 22.32 ? 63   DT  H N3    1 
ATOM   1283 C  C4    . DT  D 2 8  ? 48.393  43.494  169.687 1.00 24.43 ? 63   DT  H C4    1 
ATOM   1284 O  O4    . DT  D 2 8  ? 49.497  43.441  170.222 1.00 26.82 ? 63   DT  H O4    1 
ATOM   1285 C  C5    . DT  D 2 8  ? 47.686  44.707  169.389 1.00 20.70 ? 63   DT  H C5    1 
ATOM   1286 C  C7    . DT  D 2 8  ? 48.330  46.031  169.741 1.00 19.75 ? 63   DT  H C7    1 
ATOM   1287 C  C6    . DT  D 2 8  ? 46.453  44.675  168.864 1.00 21.49 ? 63   DT  H C6    1 
ATOM   1288 P  P     . DC  D 2 9  ? 40.219  44.283  168.830 1.00 21.91 ? 64   DC  H P     1 
ATOM   1289 O  OP1   . DC  D 2 9  ? 38.963  43.880  168.167 1.00 24.98 ? 64   DC  H OP1   1 
ATOM   1290 O  OP2   . DC  D 2 9  ? 40.404  45.642  169.358 1.00 22.93 ? 64   DC  H OP2   1 
ATOM   1291 O  "O5'" . DC  D 2 9  ? 40.568  43.231  169.923 1.00 21.54 ? 64   DC  H "O5'" 1 
ATOM   1292 C  "C5'" . DC  D 2 9  ? 40.569  41.939  169.357 1.00 17.78 ? 64   DC  H "C5'" 1 
ATOM   1293 C  "C4'" . DC  D 2 9  ? 41.135  40.908  170.271 1.00 22.33 ? 64   DC  H "C4'" 1 
ATOM   1294 O  "O4'" . DC  D 2 9  ? 42.559  41.013  170.339 1.00 23.20 ? 64   DC  H "O4'" 1 
ATOM   1295 C  "C3'" . DC  D 2 9  ? 40.613  41.102  171.662 1.00 21.58 ? 64   DC  H "C3'" 1 
ATOM   1296 O  "O3'" . DC  D 2 9  ? 40.099  39.887  172.117 1.00 34.61 ? 64   DC  H "O3'" 1 
ATOM   1297 C  "C2'" . DC  D 2 9  ? 41.860  41.381  172.477 1.00 24.50 ? 64   DC  H "C2'" 1 
ATOM   1298 C  "C1'" . DC  D 2 9  ? 43.022  40.817  171.659 1.00 18.42 ? 64   DC  H "C1'" 1 
ATOM   1299 N  N1    . DC  D 2 9  ? 44.304  41.564  171.901 1.00 16.37 ? 64   DC  H N1    1 
ATOM   1300 C  C2    . DC  D 2 9  ? 45.441  40.846  172.231 1.00 16.37 ? 64   DC  H C2    1 
ATOM   1301 O  O2    . DC  D 2 9  ? 45.449  39.616  172.161 1.00 17.53 ? 64   DC  H O2    1 
ATOM   1302 N  N3    . DC  D 2 9  ? 46.558  41.532  172.585 1.00 14.06 ? 64   DC  H N3    1 
ATOM   1303 C  C4    . DC  D 2 9  ? 46.579  42.864  172.597 1.00 15.08 ? 64   DC  H C4    1 
ATOM   1304 N  N4    . DC  D 2 9  ? 47.700  43.491  172.915 1.00 16.24 ? 64   DC  H N4    1 
ATOM   1305 C  C5    . DC  D 2 9  ? 45.429  43.624  172.247 1.00 15.11 ? 64   DC  H C5    1 
ATOM   1306 C  C6    . DC  D 2 9  ? 44.323  42.929  171.911 1.00 15.16 ? 64   DC  H C6    1 
ATOM   1307 P  P     . DA  D 2 10 ? 39.143  39.874  173.395 1.00 33.06 ? 65   DA  H P     1 
ATOM   1308 O  OP1   . DA  D 2 10 ? 37.940  39.069  173.085 1.00 32.67 ? 65   DA  H OP1   1 
ATOM   1309 O  OP2   . DA  D 2 10 ? 39.040  41.241  173.955 1.00 32.27 ? 65   DA  H OP2   1 
ATOM   1310 O  "O5'" . DA  D 2 10 ? 40.137  39.012  174.289 1.00 33.54 ? 65   DA  H "O5'" 1 
ATOM   1311 C  "C5'" . DA  D 2 10 ? 40.475  37.730  173.800 1.00 20.61 ? 65   DA  H "C5'" 1 
ATOM   1312 C  "C4'" . DA  D 2 10 ? 41.464  37.108  174.723 1.00 24.00 ? 65   DA  H "C4'" 1 
ATOM   1313 O  "O4'" . DA  D 2 10 ? 42.653  37.898  174.708 1.00 22.86 ? 65   DA  H "O4'" 1 
ATOM   1314 C  "C3'" . DA  D 2 10 ? 40.966  37.129  176.148 1.00 24.36 ? 65   DA  H "C3'" 1 
ATOM   1315 O  "O3'" . DA  D 2 10 ? 41.339  35.907  176.768 1.00 34.34 ? 65   DA  H "O3'" 1 
ATOM   1316 C  "C2'" . DA  D 2 10 ? 41.735  38.294  176.792 1.00 23.89 ? 65   DA  H "C2'" 1 
ATOM   1317 C  "C1'" . DA  D 2 10 ? 43.025  38.304  176.009 1.00 20.50 ? 65   DA  H "C1'" 1 
ATOM   1318 N  N9    . DA  D 2 10 ? 43.591  39.642  175.882 1.00 16.89 ? 65   DA  H N9    1 
ATOM   1319 C  C8    . DA  D 2 10 ? 42.951  40.830  175.678 1.00 18.04 ? 65   DA  H C8    1 
ATOM   1320 N  N7    . DA  D 2 10 ? 43.762  41.864  175.653 1.00 19.58 ? 65   DA  H N7    1 
ATOM   1321 C  C5    . DA  D 2 10 ? 45.032  41.308  175.843 1.00 17.73 ? 65   DA  H C5    1 
ATOM   1322 C  C6    . DA  D 2 10 ? 46.315  41.866  175.956 1.00 15.05 ? 65   DA  H C6    1 
ATOM   1323 N  N6    . DA  D 2 10 ? 46.565  43.161  175.820 1.00 17.39 ? 65   DA  H N6    1 
ATOM   1324 N  N1    . DA  D 2 10 ? 47.335  41.044  176.194 1.00 18.50 ? 65   DA  H N1    1 
ATOM   1325 C  C2    . DA  D 2 10 ? 47.101  39.745  176.297 1.00 16.79 ? 65   DA  H C2    1 
ATOM   1326 N  N3    . DA  D 2 10 ? 45.954  39.090  176.197 1.00 17.43 ? 65   DA  H N3    1 
ATOM   1327 C  C4    . DA  D 2 10 ? 44.936  39.953  175.973 1.00 18.19 ? 65   DA  H C4    1 
ATOM   1328 P  P     . DC  D 2 11 ? 40.740  35.503  178.192 1.00 35.85 ? 66   DC  H P     1 
ATOM   1329 O  OP1   . DC  D 2 11 ? 40.404  34.064  178.168 1.00 42.11 ? 66   DC  H OP1   1 
ATOM   1330 O  OP2   . DC  D 2 11 ? 39.718  36.502  178.593 1.00 43.53 ? 66   DC  H OP2   1 
ATOM   1331 O  "O5'" . DC  D 2 11 ? 42.006  35.731  179.109 1.00 32.92 ? 66   DC  H "O5'" 1 
ATOM   1332 C  "C5'" . DC  D 2 11 ? 43.186  35.086  178.704 1.00 31.93 ? 66   DC  H "C5'" 1 
ATOM   1333 C  "C4'" . DC  D 2 11 ? 44.382  35.583  179.451 1.00 27.96 ? 66   DC  H "C4'" 1 
ATOM   1334 O  "O4'" . DC  D 2 11 ? 44.773  36.849  178.929 1.00 26.58 ? 66   DC  H "O4'" 1 
ATOM   1335 C  "C3'" . DC  D 2 11 ? 44.104  35.791  180.925 1.00 30.51 ? 66   DC  H "C3'" 1 
ATOM   1336 O  "O3'" . DC  D 2 11 ? 45.168  35.234  181.693 1.00 37.87 ? 66   DC  H "O3'" 1 
ATOM   1337 C  "C2'" . DC  D 2 11 ? 44.166  37.323  181.063 1.00 27.49 ? 66   DC  H "C2'" 1 
ATOM   1338 C  "C1'" . DC  D 2 11 ? 45.156  37.689  179.991 1.00 20.51 ? 66   DC  H "C1'" 1 
ATOM   1339 N  N1    . DC  D 2 11 ? 45.038  39.071  179.565 1.00 23.61 ? 66   DC  H N1    1 
ATOM   1340 C  C2    . DC  D 2 11 ? 46.194  39.814  179.483 1.00 23.66 ? 66   DC  H C2    1 
ATOM   1341 O  O2    . DC  D 2 11 ? 47.287  39.263  179.484 1.00 26.77 ? 66   DC  H O2    1 
ATOM   1342 N  N3    . DC  D 2 11 ? 46.097  41.134  179.239 1.00 25.59 ? 66   DC  H N3    1 
ATOM   1343 C  C4    . DC  D 2 11 ? 44.898  41.689  179.051 1.00 24.89 ? 66   DC  H C4    1 
ATOM   1344 N  N4    . DC  D 2 11 ? 44.821  42.996  178.836 1.00 26.69 ? 66   DC  H N4    1 
ATOM   1345 C  C5    . DC  D 2 11 ? 43.696  40.928  179.093 1.00 22.74 ? 66   DC  H C5    1 
ATOM   1346 C  C6    . DC  D 2 11 ? 43.824  39.616  179.357 1.00 22.83 ? 66   DC  H C6    1 
ATOM   1347 P  P     . DC  D 2 12 ? 45.044  35.067  183.278 1.00 35.80 ? 67   DC  H P     1 
ATOM   1348 O  OP1   . DC  D 2 12 ? 45.247  33.645  183.632 1.00 34.59 ? 67   DC  H OP1   1 
ATOM   1349 O  OP2   . DC  D 2 12 ? 43.819  35.779  183.698 1.00 40.63 ? 67   DC  H OP2   1 
ATOM   1350 O  "O5'" . DC  D 2 12 ? 46.305  35.919  183.739 1.00 31.33 ? 67   DC  H "O5'" 1 
ATOM   1351 C  "C5'" . DC  D 2 12 ? 47.470  35.683  182.989 1.00 26.94 ? 67   DC  H "C5'" 1 
ATOM   1352 C  "C4'" . DC  D 2 12 ? 48.541  36.654  183.358 1.00 30.17 ? 67   DC  H "C4'" 1 
ATOM   1353 O  "O4'" . DC  D 2 12 ? 48.315  37.852  182.642 1.00 26.69 ? 67   DC  H "O4'" 1 
ATOM   1354 C  "C3'" . DC  D 2 12 ? 48.449  37.037  184.821 1.00 37.70 ? 67   DC  H "C3'" 1 
ATOM   1355 O  "O3'" . DC  D 2 12 ? 49.648  36.966  185.562 1.00 41.02 ? 67   DC  H "O3'" 1 
ATOM   1356 C  "C2'" . DC  D 2 12 ? 48.090  38.509  184.843 1.00 35.68 ? 67   DC  H "C2'" 1 
ATOM   1357 C  "C1'" . DC  D 2 12 ? 48.443  38.985  183.475 1.00 27.52 ? 67   DC  H "C1'" 1 
ATOM   1358 N  N1    . DC  D 2 12 ? 47.443  39.990  183.105 1.00 28.48 ? 67   DC  H N1    1 
ATOM   1359 C  C2    . DC  D 2 12 ? 47.925  41.256  182.888 1.00 28.53 ? 67   DC  H C2    1 
ATOM   1360 O  O2    . DC  D 2 12 ? 49.136  41.428  182.936 1.00 29.20 ? 67   DC  H O2    1 
ATOM   1361 N  N3    . DC  D 2 12 ? 47.065  42.262  182.595 1.00 28.24 ? 67   DC  H N3    1 
ATOM   1362 C  C4    . DC  D 2 12 ? 45.758  42.002  182.506 1.00 28.53 ? 67   DC  H C4    1 
ATOM   1363 N  N4    . DC  D 2 12 ? 44.931  42.991  182.178 1.00 27.17 ? 67   DC  H N4    1 
ATOM   1364 C  C5    . DC  D 2 12 ? 45.233  40.678  182.734 1.00 27.64 ? 67   DC  H C5    1 
ATOM   1365 C  C6    . DC  D 2 12 ? 46.116  39.701  183.034 1.00 27.03 ? 67   DC  H C6    1 
ATOM   1366 P  P     . DC  D 2 13 ? 49.450  36.622  187.117 1.00 38.08 ? 68   DC  H P     1 
ATOM   1367 O  OP1   . DC  D 2 13 ? 50.542  35.709  187.499 1.00 41.69 ? 68   DC  H OP1   1 
ATOM   1368 O  OP2   . DC  D 2 13 ? 48.035  36.283  187.406 1.00 36.64 ? 68   DC  H OP2   1 
ATOM   1369 O  "O5'" . DC  D 2 13 ? 49.782  38.065  187.638 1.00 31.56 ? 68   DC  H "O5'" 1 
ATOM   1370 C  "C5'" . DC  D 2 13 ? 51.068  38.443  187.208 1.00 30.45 ? 68   DC  H "C5'" 1 
ATOM   1371 C  "C4'" . DC  D 2 13 ? 51.345  39.856  187.560 1.00 34.99 ? 68   DC  H "C4'" 1 
ATOM   1372 O  "O4'" . DC  D 2 13 ? 50.513  40.716  186.782 1.00 38.64 ? 68   DC  H "O4'" 1 
ATOM   1373 C  "C3'" . DC  D 2 13 ? 50.950  40.053  188.994 1.00 39.21 ? 68   DC  H "C3'" 1 
ATOM   1374 O  "O3'" . DC  D 2 13 ? 51.898  40.914  189.602 1.00 46.83 ? 68   DC  H "O3'" 1 
ATOM   1375 C  "C2'" . DC  D 2 13 ? 49.581  40.740  188.863 1.00 39.44 ? 68   DC  H "C2'" 1 
ATOM   1376 C  "C1'" . DC  D 2 13 ? 49.752  41.570  187.613 1.00 30.50 ? 68   DC  H "C1'" 1 
ATOM   1377 N  N1    . DC  D 2 13 ? 48.474  41.876  186.969 1.00 28.84 ? 68   DC  H N1    1 
ATOM   1378 C  C2    . DC  D 2 13 ? 48.281  43.160  186.482 1.00 28.34 ? 68   DC  H C2    1 
ATOM   1379 O  O2    . DC  D 2 13 ? 49.135  44.031  186.610 1.00 29.76 ? 68   DC  H O2    1 
ATOM   1380 N  N3    . DC  D 2 13 ? 47.097  43.474  185.928 1.00 28.41 ? 68   DC  H N3    1 
ATOM   1381 C  C4    . DC  D 2 13 ? 46.131  42.567  185.861 1.00 30.81 ? 68   DC  H C4    1 
ATOM   1382 N  N4    . DC  D 2 13 ? 44.967  42.944  185.346 1.00 31.30 ? 68   DC  H N4    1 
ATOM   1383 C  C5    . DC  D 2 13 ? 46.304  41.229  186.353 1.00 29.81 ? 68   DC  H C5    1 
ATOM   1384 C  C6    . DC  D 2 13 ? 47.501  40.934  186.896 1.00 28.61 ? 68   DC  H C6    1 
ATOM   1385 P  P     . DC  D 2 14 ? 51.896  41.144  191.191 1.00 49.94 ? 69   DC  H P     1 
ATOM   1386 O  OP1   . DC  D 2 14 ? 53.304  41.149  191.637 1.00 60.70 ? 69   DC  H OP1   1 
ATOM   1387 O  OP2   . DC  D 2 14 ? 50.923  40.222  191.820 1.00 52.58 ? 69   DC  H OP2   1 
ATOM   1388 O  "O5'" . DC  D 2 14 ? 51.339  42.643  191.234 1.00 41.47 ? 69   DC  H "O5'" 1 
ATOM   1389 C  "C5'" . DC  D 2 14 ? 51.896  43.436  190.199 1.00 38.53 ? 69   DC  H "C5'" 1 
ATOM   1390 C  "C4'" . DC  D 2 14 ? 51.474  44.860  190.259 1.00 38.99 ? 69   DC  H "C4'" 1 
ATOM   1391 O  "O4'" . DC  D 2 14 ? 50.342  45.079  189.428 1.00 38.47 ? 69   DC  H "O4'" 1 
ATOM   1392 C  "C3'" . DC  D 2 14 ? 51.062  45.207  191.658 1.00 42.57 ? 69   DC  H "C3'" 1 
ATOM   1393 O  "O3'" . DC  D 2 14 ? 51.327  46.580  191.895 1.00 52.51 ? 69   DC  H "O3'" 1 
ATOM   1394 C  "C2'" . DC  D 2 14 ? 49.565  45.009  191.584 1.00 41.93 ? 69   DC  H "C2'" 1 
ATOM   1395 C  "C1'" . DC  D 2 14 ? 49.265  45.566  190.210 1.00 32.27 ? 69   DC  H "C1'" 1 
ATOM   1396 N  N1    . DC  D 2 14 ? 48.000  45.027  189.714 1.00 29.14 ? 69   DC  H N1    1 
ATOM   1397 C  C2    . DC  D 2 14 ? 47.076  45.906  189.204 1.00 28.31 ? 69   DC  H C2    1 
ATOM   1398 O  O2    . DC  D 2 14 ? 47.330  47.109  189.168 1.00 27.55 ? 69   DC  H O2    1 
ATOM   1399 N  N3    . DC  D 2 14 ? 45.876  45.408  188.808 1.00 26.86 ? 69   DC  H N3    1 
ATOM   1400 C  C4    . DC  D 2 14 ? 45.604  44.097  188.916 1.00 27.06 ? 69   DC  H C4    1 
ATOM   1401 N  N4    . DC  D 2 14 ? 44.410  43.619  188.565 1.00 28.27 ? 69   DC  H N4    1 
ATOM   1402 C  C5    . DC  D 2 14 ? 46.561  43.178  189.438 1.00 27.46 ? 69   DC  H C5    1 
ATOM   1403 C  C6    . DC  D 2 14 ? 47.744  43.695  189.823 1.00 29.28 ? 69   DC  H C6    1 
ATOM   1404 P  P     . DA  D 2 15 ? 51.235  47.142  193.394 1.00 58.56 ? 70   DA  H P     1 
ATOM   1405 O  OP1   . DA  D 2 15 ? 52.444  47.962  193.649 1.00 57.87 ? 70   DA  H OP1   1 
ATOM   1406 O  OP2   . DA  D 2 15 ? 50.849  46.023  194.294 1.00 57.29 ? 70   DA  H OP2   1 
ATOM   1407 O  "O5'" . DA  D 2 15 ? 50.018  48.153  193.250 1.00 53.66 ? 70   DA  H "O5'" 1 
ATOM   1408 C  "C5'" . DA  D 2 15 ? 50.322  49.259  192.421 1.00 46.01 ? 70   DA  H "C5'" 1 
ATOM   1409 C  "C4'" . DA  D 2 15 ? 49.154  50.175  192.340 1.00 42.99 ? 70   DA  H "C4'" 1 
ATOM   1410 O  "O4'" . DA  D 2 15 ? 48.052  49.517  191.701 1.00 41.98 ? 70   DA  H "O4'" 1 
ATOM   1411 C  "C3'" . DA  D 2 15 ? 48.717  50.509  193.748 1.00 39.72 ? 70   DA  H "C3'" 1 
ATOM   1412 O  "O3'" . DA  D 2 15 ? 48.259  51.851  193.744 1.00 46.72 ? 70   DA  H "O3'" 1 
ATOM   1413 C  "C2'" . DA  D 2 15 ? 47.567  49.533  193.980 1.00 35.09 ? 70   DA  H "C2'" 1 
ATOM   1414 C  "C1'" . DA  D 2 15 ? 46.947  49.450  192.594 1.00 30.26 ? 70   DA  H "C1'" 1 
ATOM   1415 N  N9    . DA  D 2 15 ? 46.239  48.188  192.382 1.00 24.51 ? 70   DA  H N9    1 
ATOM   1416 C  C8    . DA  D 2 15 ? 46.596  46.936  192.783 1.00 24.22 ? 70   DA  H C8    1 
ATOM   1417 N  N7    . DA  D 2 15 ? 45.740  46.009  192.442 1.00 25.68 ? 70   DA  H N7    1 
ATOM   1418 C  C5    . DA  D 2 15 ? 44.749  46.700  191.750 1.00 22.54 ? 70   DA  H C5    1 
ATOM   1419 C  C6    . DA  D 2 15 ? 43.558  46.291  191.136 1.00 22.10 ? 70   DA  H C6    1 
ATOM   1420 N  N6    . DA  D 2 15 ? 43.179  45.018  191.023 1.00 22.30 ? 70   DA  H N6    1 
ATOM   1421 N  N1    . DA  D 2 15 ? 42.803  47.244  190.588 1.00 23.55 ? 70   DA  H N1    1 
ATOM   1422 C  C2    . DA  D 2 15 ? 43.205  48.506  190.624 1.00 22.64 ? 70   DA  H C2    1 
ATOM   1423 N  N3    . DA  D 2 15 ? 44.305  49.020  191.148 1.00 23.40 ? 70   DA  H N3    1 
ATOM   1424 C  C4    . DA  D 2 15 ? 45.045  48.036  191.713 1.00 26.91 ? 70   DA  H C4    1 
ATOM   1425 P  P     . DC  D 2 16 ? 47.894  52.571  195.116 1.00 54.80 ? 71   DC  H P     1 
ATOM   1426 O  OP1   . DC  D 2 16 ? 48.437  53.950  195.085 1.00 55.82 ? 71   DC  H OP1   1 
ATOM   1427 O  OP2   . DC  D 2 16 ? 48.199  51.652  196.235 1.00 63.37 ? 71   DC  H OP2   1 
ATOM   1428 O  "O5'" . DC  D 2 16 ? 46.330  52.658  194.993 1.00 52.03 ? 71   DC  H "O5'" 1 
ATOM   1429 C  "C5'" . DC  D 2 16 ? 45.879  53.424  193.901 1.00 47.63 ? 71   DC  H "C5'" 1 
ATOM   1430 C  "C4'" . DC  D 2 16 ? 44.410  53.235  193.754 1.00 45.91 ? 71   DC  H "C4'" 1 
ATOM   1431 O  "O4'" . DC  D 2 16 ? 44.079  51.877  193.428 1.00 40.63 ? 71   DC  H "O4'" 1 
ATOM   1432 C  "C3'" . DC  D 2 16 ? 43.760  53.501  195.082 1.00 46.18 ? 71   DC  H "C3'" 1 
ATOM   1433 O  "O3'" . DC  D 2 16 ? 42.541  54.157  194.812 1.00 58.13 ? 71   DC  H "O3'" 1 
ATOM   1434 C  "C2'" . DC  D 2 16 ? 43.485  52.089  195.600 1.00 36.31 ? 71   DC  H "C2'" 1 
ATOM   1435 C  "C1'" . DC  D 2 16 ? 43.076  51.425  194.318 1.00 29.74 ? 71   DC  H "C1'" 1 
ATOM   1436 N  N1    . DC  D 2 16 ? 43.020  49.959  194.365 1.00 27.65 ? 71   DC  H N1    1 
ATOM   1437 C  C2    . DC  D 2 16 ? 41.920  49.369  193.789 1.00 24.83 ? 71   DC  H C2    1 
ATOM   1438 O  O2    . DC  D 2 16 ? 41.124  50.061  193.165 1.00 28.78 ? 71   DC  H O2    1 
ATOM   1439 N  N3    . DC  D 2 16 ? 41.794  48.020  193.847 1.00 25.31 ? 71   DC  H N3    1 
ATOM   1440 C  C4    . DC  D 2 16 ? 42.734  47.280  194.441 1.00 26.04 ? 71   DC  H C4    1 
ATOM   1441 N  N4    . DC  D 2 16 ? 42.616  45.957  194.445 1.00 25.01 ? 71   DC  H N4    1 
ATOM   1442 C  C5    . DC  D 2 16 ? 43.887  47.877  195.027 1.00 25.15 ? 71   DC  H C5    1 
ATOM   1443 C  C6    . DC  D 2 16 ? 43.984  49.221  194.963 1.00 25.11 ? 71   DC  H C6    1 
ATOM   1444 P  P     . DT  D 2 17 ? 42.062  55.351  195.769 1.00 53.94 ? 72   DT  H P     1 
ATOM   1445 O  OP1   . DT  D 2 17 ? 42.709  56.613  195.322 1.00 59.28 ? 72   DT  H OP1   1 
ATOM   1446 O  OP2   . DT  D 2 17 ? 42.166  54.884  197.179 1.00 64.90 ? 72   DT  H OP2   1 
ATOM   1447 O  "O5'" . DT  D 2 17 ? 40.518  55.385  195.354 1.00 57.81 ? 72   DT  H "O5'" 1 
ATOM   1448 C  "C5'" . DT  D 2 17 ? 40.147  54.676  194.181 1.00 51.31 ? 72   DT  H "C5'" 1 
ATOM   1449 C  "C4'" . DT  D 2 17 ? 38.816  54.019  194.354 1.00 44.93 ? 72   DT  H "C4'" 1 
ATOM   1450 O  "O4'" . DT  D 2 17 ? 38.947  52.610  194.470 1.00 45.61 ? 72   DT  H "O4'" 1 
ATOM   1451 C  "C3'" . DT  D 2 17 ? 38.140  54.467  195.629 1.00 47.26 ? 72   DT  H "C3'" 1 
ATOM   1452 O  "O3'" . DT  D 2 17 ? 36.740  54.331  195.441 1.00 53.82 ? 72   DT  H "O3'" 1 
ATOM   1453 C  "C2'" . DT  D 2 17 ? 38.586  53.394  196.598 1.00 45.15 ? 72   DT  H "C2'" 1 
ATOM   1454 C  "C1'" . DT  D 2 17 ? 38.330  52.226  195.686 1.00 37.83 ? 72   DT  H "C1'" 1 
ATOM   1455 N  N1    . DT  D 2 17 ? 38.840  50.932  196.132 1.00 34.69 ? 72   DT  H N1    1 
ATOM   1456 C  C2    . DT  D 2 17 ? 38.058  49.871  195.757 1.00 31.82 ? 72   DT  H C2    1 
ATOM   1457 O  O2    . DT  D 2 17 ? 36.947  50.047  195.262 1.00 33.07 ? 72   DT  H O2    1 
ATOM   1458 N  N3    . DT  D 2 17 ? 38.560  48.624  196.045 1.00 30.71 ? 72   DT  H N3    1 
ATOM   1459 C  C4    . DT  D 2 17 ? 39.760  48.376  196.671 1.00 32.96 ? 72   DT  H C4    1 
ATOM   1460 O  O4    . DT  D 2 17 ? 40.171  47.232  196.793 1.00 30.36 ? 72   DT  H O4    1 
ATOM   1461 C  C5    . DT  D 2 17 ? 40.497  49.547  197.038 1.00 27.62 ? 72   DT  H C5    1 
ATOM   1462 C  C7    . DT  D 2 17 ? 41.859  49.366  197.656 1.00 29.55 ? 72   DT  H C7    1 
ATOM   1463 C  C6    . DT  D 2 17 ? 40.031  50.771  196.772 1.00 29.77 ? 72   DT  H C6    1 
ATOM   1464 P  P     . DG  D 2 18 ? 35.791  55.388  196.170 1.00 55.26 ? 73   DG  H P     1 
ATOM   1465 O  OP1   . DG  D 2 18 ? 35.418  56.443  195.197 1.00 64.56 ? 73   DG  H OP1   1 
ATOM   1466 O  OP2   . DG  D 2 18 ? 36.396  55.726  197.487 1.00 59.77 ? 73   DG  H OP2   1 
ATOM   1467 O  "O5'" . DG  D 2 18 ? 34.498  54.523  196.421 1.00 54.11 ? 73   DG  H "O5'" 1 
ATOM   1468 C  "C5'" . DG  D 2 18 ? 33.856  53.899  195.333 1.00 45.68 ? 73   DG  H "C5'" 1 
ATOM   1469 C  "C4'" . DG  D 2 18 ? 33.181  52.687  195.885 1.00 41.09 ? 73   DG  H "C4'" 1 
ATOM   1470 O  "O4'" . DG  D 2 18 ? 34.141  51.737  196.351 1.00 40.33 ? 73   DG  H "O4'" 1 
ATOM   1471 C  "C3'" . DG  D 2 18 ? 32.413  53.095  197.132 1.00 42.66 ? 73   DG  H "C3'" 1 
ATOM   1472 O  "O3'" . DG  D 2 18 ? 31.387  52.147  197.341 1.00 49.42 ? 73   DG  H "O3'" 1 
ATOM   1473 C  "C2'" . DG  D 2 18 ? 33.442  52.898  198.222 1.00 35.58 ? 73   DG  H "C2'" 1 
ATOM   1474 C  "C1'" . DG  D 2 18 ? 33.966  51.567  197.757 1.00 32.52 ? 73   DG  H "C1'" 1 
ATOM   1475 N  N9    . DG  D 2 18 ? 35.205  51.186  198.420 1.00 25.86 ? 73   DG  H N9    1 
ATOM   1476 C  C8    . DG  D 2 18 ? 36.198  51.988  198.915 1.00 24.34 ? 73   DG  H C8    1 
ATOM   1477 N  N7    . DG  D 2 18 ? 37.250  51.308  199.300 1.00 27.43 ? 73   DG  H N7    1 
ATOM   1478 C  C5    . DG  D 2 18 ? 36.920  49.971  199.044 1.00 25.83 ? 73   DG  H C5    1 
ATOM   1479 C  C6    . DG  D 2 18 ? 37.691  48.795  199.201 1.00 26.91 ? 73   DG  H C6    1 
ATOM   1480 O  O6    . DG  D 2 18 ? 38.852  48.707  199.587 1.00 31.67 ? 73   DG  H O6    1 
ATOM   1481 N  N1    . DG  D 2 18 ? 37.021  47.656  198.794 1.00 25.34 ? 73   DG  H N1    1 
ATOM   1482 C  C2    . DG  D 2 18 ? 35.741  47.652  198.300 1.00 24.69 ? 73   DG  H C2    1 
ATOM   1483 N  N2    . DG  D 2 18 ? 35.230  46.461  198.004 1.00 23.54 ? 73   DG  H N2    1 
ATOM   1484 N  N3    . DG  D 2 18 ? 35.005  48.764  198.137 1.00 24.72 ? 73   DG  H N3    1 
ATOM   1485 C  C4    . DG  D 2 18 ? 35.664  49.885  198.524 1.00 24.27 ? 73   DG  H C4    1 
ATOM   1486 P  P     . DC  D 2 19 ? 29.923  52.682  197.640 1.00 52.70 ? 74   DC  H P     1 
ATOM   1487 O  OP1   . DC  D 2 19 ? 29.340  53.212  196.389 1.00 54.30 ? 74   DC  H OP1   1 
ATOM   1488 O  OP2   . DC  D 2 19 ? 29.961  53.507  198.870 1.00 52.20 ? 74   DC  H OP2   1 
ATOM   1489 O  "O5'" . DC  D 2 19 ? 29.223  51.292  197.939 1.00 51.60 ? 74   DC  H "O5'" 1 
ATOM   1490 C  "C5'" . DC  D 2 19 ? 29.579  50.166  197.144 1.00 45.90 ? 74   DC  H "C5'" 1 
ATOM   1491 C  "C4'" . DC  D 2 19 ? 29.462  48.890  197.951 1.00 42.29 ? 74   DC  H "C4'" 1 
ATOM   1492 O  "O4'" . DC  D 2 19 ? 30.707  48.514  198.558 1.00 43.04 ? 74   DC  H "O4'" 1 
ATOM   1493 C  "C3'" . DC  D 2 19 ? 28.512  49.121  199.108 1.00 41.93 ? 74   DC  H "C3'" 1 
ATOM   1494 O  "O3'" . DC  D 2 19 ? 28.019  47.860  199.500 1.00 46.39 ? 74   DC  H "O3'" 1 
ATOM   1495 C  "C2'" . DC  D 2 19 ? 29.466  49.650  200.170 1.00 37.00 ? 74   DC  H "C2'" 1 
ATOM   1496 C  "C1'" . DC  D 2 19 ? 30.631  48.684  199.973 1.00 31.40 ? 74   DC  H "C1'" 1 
ATOM   1497 N  N1    . DC  D 2 19 ? 31.910  49.190  200.523 1.00 26.77 ? 74   DC  H N1    1 
ATOM   1498 C  C2    . DC  D 2 19 ? 32.871  48.247  200.776 1.00 24.52 ? 74   DC  H C2    1 
ATOM   1499 O  O2    . DC  D 2 19 ? 32.590  47.074  200.551 1.00 26.09 ? 74   DC  H O2    1 
ATOM   1500 N  N3    . DC  D 2 19 ? 34.052  48.639  201.333 1.00 23.81 ? 74   DC  H N3    1 
ATOM   1501 C  C4    . DC  D 2 19 ? 34.250  49.938  201.633 1.00 24.89 ? 74   DC  H C4    1 
ATOM   1502 N  N4    . DC  D 2 19 ? 35.407  50.349  202.151 1.00 24.23 ? 74   DC  H N4    1 
ATOM   1503 C  C5    . DC  D 2 19 ? 33.251  50.928  201.386 1.00 22.87 ? 74   DC  H C5    1 
ATOM   1504 C  C6    . DC  D 2 19 ? 32.102  50.505  200.825 1.00 24.26 ? 74   DC  H C6    1 
ATOM   1505 P  P     . DA  D 2 20 ? 26.677  47.313  198.844 1.00 55.96 ? 75   DA  H P     1 
ATOM   1506 O  OP1   . DA  D 2 20 ? 26.798  47.375  197.369 1.00 63.41 ? 75   DA  H OP1   1 
ATOM   1507 O  OP2   . DA  D 2 20 ? 25.529  47.963  199.510 1.00 63.91 ? 75   DA  H OP2   1 
ATOM   1508 O  "O5'" . DA  D 2 20 ? 26.787  45.788  199.329 1.00 50.27 ? 75   DA  H "O5'" 1 
ATOM   1509 C  "C5'" . DA  D 2 20 ? 28.077  45.208  199.179 1.00 46.46 ? 75   DA  H "C5'" 1 
ATOM   1510 C  "C4'" . DA  D 2 20 ? 28.275  43.982  200.030 1.00 47.36 ? 75   DA  H "C4'" 1 
ATOM   1511 O  "O4'" . DA  D 2 20 ? 29.250  44.253  201.024 1.00 44.77 ? 75   DA  H "O4'" 1 
ATOM   1512 C  "C3'" . DA  D 2 20 ? 27.034  43.587  200.805 1.00 51.61 ? 75   DA  H "C3'" 1 
ATOM   1513 O  "O3'" . DA  D 2 20 ? 27.241  42.230  201.242 1.00 64.14 ? 75   DA  H "O3'" 1 
ATOM   1514 C  "C2'" . DA  D 2 20 ? 27.126  44.590  201.952 1.00 42.37 ? 75   DA  H "C2'" 1 
ATOM   1515 C  "C1'" . DA  D 2 20 ? 28.618  44.550  202.261 1.00 31.99 ? 75   DA  H "C1'" 1 
ATOM   1516 N  N9    . DA  D 2 20 ? 29.101  45.855  202.675 1.00 26.10 ? 75   DA  H N9    1 
ATOM   1517 C  C8    . DA  D 2 20 ? 28.448  47.054  202.665 1.00 26.27 ? 75   DA  H C8    1 
ATOM   1518 N  N7    . DA  D 2 20 ? 29.164  48.054  203.125 1.00 26.81 ? 75   DA  H N7    1 
ATOM   1519 C  C5    . DA  D 2 20 ? 30.375  47.463  203.450 1.00 24.64 ? 75   DA  H C5    1 
ATOM   1520 C  C6    . DA  D 2 20 ? 31.558  47.989  203.952 1.00 23.07 ? 75   DA  H C6    1 
ATOM   1521 N  N6    . DA  D 2 20 ? 31.699  49.280  204.229 1.00 24.41 ? 75   DA  H N6    1 
ATOM   1522 N  N1    . DA  D 2 20 ? 32.575  47.142  204.130 1.00 24.52 ? 75   DA  H N1    1 
ATOM   1523 C  C2    . DA  D 2 20 ? 32.403  45.860  203.833 1.00 24.48 ? 75   DA  H C2    1 
ATOM   1524 N  N3    . DA  D 2 20 ? 31.337  45.232  203.351 1.00 23.61 ? 75   DA  H N3    1 
ATOM   1525 C  C4    . DA  D 2 20 ? 30.345  46.122  203.177 1.00 25.89 ? 75   DA  H C4    1 
ATOM   1526 P  P     . DA  D 2 21 ? 26.162  41.313  202.042 1.00 60.85 ? 76   DA  H P     1 
ATOM   1527 O  OP1   . DA  D 2 21 ? 25.876  40.149  201.164 1.00 60.89 ? 76   DA  H OP1   1 
ATOM   1528 O  OP2   . DA  D 2 21 ? 25.061  42.172  202.552 1.00 64.49 ? 76   DA  H OP2   1 
ATOM   1529 O  "O5'" . DA  D 2 21 ? 26.976  40.811  203.339 1.00 63.27 ? 76   DA  H "O5'" 1 
ATOM   1530 C  "C5'" . DA  D 2 21 ? 28.232  40.159  203.200 1.00 51.60 ? 76   DA  H "C5'" 1 
ATOM   1531 C  "C4'" . DA  D 2 21 ? 29.052  40.281  204.471 1.00 47.98 ? 76   DA  H "C4'" 1 
ATOM   1532 O  "O4'" . DA  D 2 21 ? 29.468  41.637  204.717 1.00 44.44 ? 76   DA  H "O4'" 1 
ATOM   1533 C  "C3'" . DA  D 2 21 ? 28.221  39.854  205.671 1.00 46.14 ? 76   DA  H "C3'" 1 
ATOM   1534 O  "O3'" . DA  D 2 21 ? 29.087  39.293  206.664 1.00 51.18 ? 76   DA  H "O3'" 1 
ATOM   1535 C  "C2'" . DA  D 2 21 ? 27.697  41.206  206.137 1.00 41.29 ? 76   DA  H "C2'" 1 
ATOM   1536 C  "C1'" . DA  D 2 21 ? 28.948  42.066  205.974 1.00 36.30 ? 76   DA  H "C1'" 1 
ATOM   1537 N  N9    . DA  D 2 21 ? 28.658  43.514  206.012 1.00 29.89 ? 76   DA  H N9    1 
ATOM   1538 C  C8    . DA  D 2 21 ? 27.513  44.168  205.641 1.00 27.82 ? 76   DA  H C8    1 
ATOM   1539 N  N7    . DA  D 2 21 ? 27.575  45.461  205.811 1.00 27.56 ? 76   DA  H N7    1 
ATOM   1540 C  C5    . DA  D 2 21 ? 28.844  45.686  206.339 1.00 24.21 ? 76   DA  H C5    1 
ATOM   1541 C  C6    . DA  D 2 21 ? 29.543  46.865  206.680 1.00 30.19 ? 76   DA  H C6    1 
ATOM   1542 N  N6    . DA  D 2 21 ? 28.987  48.086  206.688 1.00 25.61 ? 76   DA  H N6    1 
ATOM   1543 N  N1    . DA  D 2 21 ? 30.823  46.726  207.065 1.00 26.10 ? 76   DA  H N1    1 
ATOM   1544 C  C2    . DA  D 2 21 ? 31.351  45.510  207.113 1.00 26.56 ? 76   DA  H C2    1 
ATOM   1545 N  N3    . DA  D 2 21 ? 30.792  44.337  206.839 1.00 26.90 ? 76   DA  H N3    1 
ATOM   1546 C  C4    . DA  D 2 21 ? 29.514  44.503  206.452 1.00 23.80 ? 76   DA  H C4    1 
ATOM   1547 N  N     . GLN E 3 1  ? 66.556  44.237  144.686 1.00 47.23 ? 319  GLN A N     1 
ATOM   1548 C  CA    . GLN E 3 1  ? 66.639  43.893  143.231 1.00 46.83 ? 319  GLN A CA    1 
ATOM   1549 C  C     . GLN E 3 1  ? 65.724  44.759  142.378 1.00 45.96 ? 319  GLN A C     1 
ATOM   1550 O  O     . GLN E 3 1  ? 64.520  44.810  142.607 1.00 49.06 ? 319  GLN A O     1 
ATOM   1551 C  CB    . GLN E 3 1  ? 66.309  42.415  142.994 1.00 42.92 ? 319  GLN A CB    1 
ATOM   1552 C  CG    . GLN E 3 1  ? 67.375  41.436  143.492 1.00 46.25 ? 319  GLN A CG    1 
ATOM   1553 C  CD    . GLN E 3 1  ? 66.991  39.964  143.290 1.00 48.67 ? 319  GLN A CD    1 
ATOM   1554 O  OE1   . GLN E 3 1  ? 67.813  39.061  143.502 1.00 51.31 ? 319  GLN A OE1   1 
ATOM   1555 N  NE2   . GLN E 3 1  ? 65.743  39.718  142.880 1.00 47.45 ? 319  GLN A NE2   1 
ATOM   1556 N  N     . SER E 3 2  ? 66.321  45.459  141.416 1.00 46.35 ? 320  SER A N     1 
ATOM   1557 C  CA    . SER E 3 2  ? 65.622  46.334  140.461 1.00 46.98 ? 320  SER A CA    1 
ATOM   1558 C  C     . SER E 3 2  ? 64.954  45.431  139.428 1.00 47.32 ? 320  SER A C     1 
ATOM   1559 O  O     . SER E 3 2  ? 65.362  44.278  139.283 1.00 46.68 ? 320  SER A O     1 
ATOM   1560 C  CB    . SER E 3 2  ? 66.665  47.126  139.716 1.00 47.00 ? 320  SER A CB    1 
ATOM   1561 O  OG    . SER E 3 2  ? 67.603  46.213  139.152 1.00 44.62 ? 320  SER A OG    1 
ATOM   1562 N  N     . ARG E 3 3  ? 64.035  45.964  138.627 1.00 41.73 ? 321  ARG A N     1 
ATOM   1563 C  CA    . ARG E 3 3  ? 63.379  45.113  137.636 1.00 42.18 ? 321  ARG A CA    1 
ATOM   1564 C  C     . ARG E 3 3  ? 64.470  44.387  136.875 1.00 41.15 ? 321  ARG A C     1 
ATOM   1565 O  O     . ARG E 3 3  ? 64.454  43.161  136.785 1.00 44.78 ? 321  ARG A O     1 
ATOM   1566 C  CB    . ARG E 3 3  ? 62.514  45.924  136.668 1.00 36.55 ? 321  ARG A CB    1 
ATOM   1567 N  N     . GLY E 3 4  ? 65.502  45.138  136.505 1.00 37.27 ? 322  GLY A N     1 
ATOM   1568 C  CA    . GLY E 3 4  ? 66.586  44.579  135.739 1.00 34.15 ? 322  GLY A CA    1 
ATOM   1569 C  C     . GLY E 3 4  ? 67.302  43.476  136.453 1.00 34.90 ? 322  GLY A C     1 
ATOM   1570 O  O     . GLY E 3 4  ? 67.718  42.502  135.824 1.00 38.35 ? 322  GLY A O     1 
ATOM   1571 N  N     . GLU E 3 5  ? 67.488  43.633  137.758 1.00 35.33 ? 323  GLU A N     1 
ATOM   1572 C  CA    . GLU E 3 5  ? 68.171  42.605  138.526 1.00 36.65 ? 323  GLU A CA    1 
ATOM   1573 C  C     . GLU E 3 5  ? 67.279  41.408  138.757 1.00 35.46 ? 323  GLU A C     1 
ATOM   1574 O  O     . GLU E 3 5  ? 67.700  40.262  138.638 1.00 34.02 ? 323  GLU A O     1 
ATOM   1575 C  CB    . GLU E 3 5  ? 68.619  43.163  139.851 1.00 42.89 ? 323  GLU A CB    1 
ATOM   1576 C  CG    . GLU E 3 5  ? 69.675  44.185  139.703 1.00 48.88 ? 323  GLU A CG    1 
ATOM   1577 C  CD    . GLU E 3 5  ? 70.139  44.662  141.031 1.00 62.04 ? 323  GLU A CD    1 
ATOM   1578 O  OE1   . GLU E 3 5  ? 69.349  45.346  141.722 1.00 58.92 ? 323  GLU A OE1   1 
ATOM   1579 O  OE2   . GLU E 3 5  ? 71.293  44.334  141.384 1.00 68.63 ? 323  GLU A OE2   1 
ATOM   1580 N  N     . LYS E 3 6  ? 66.036  41.701  139.096 1.00 36.60 ? 324  LYS A N     1 
ATOM   1581 C  CA    . LYS E 3 6  ? 65.038  40.691  139.340 1.00 42.60 ? 324  LYS A CA    1 
ATOM   1582 C  C     . LYS E 3 6  ? 64.946  39.814  138.075 1.00 40.81 ? 324  LYS A C     1 
ATOM   1583 O  O     . LYS E 3 6  ? 64.977  38.593  138.159 1.00 40.67 ? 324  LYS A O     1 
ATOM   1584 C  CB    . LYS E 3 6  ? 63.711  41.387  139.662 1.00 41.58 ? 324  LYS A CB    1 
ATOM   1585 C  CG    . LYS E 3 6  ? 62.548  40.465  139.979 1.00 49.79 ? 324  LYS A CG    1 
ATOM   1586 C  CD    . LYS E 3 6  ? 61.257  41.253  140.180 1.00 50.09 ? 324  LYS A CD    1 
ATOM   1587 C  CE    . LYS E 3 6  ? 61.004  42.182  138.975 1.00 67.92 ? 324  LYS A CE    1 
ATOM   1588 N  NZ    . LYS E 3 6  ? 59.743  42.991  139.036 1.00 63.87 ? 324  LYS A NZ    1 
ATOM   1589 N  N     . ARG E 3 7  ? 64.969  40.455  136.909 1.00 42.19 ? 325  ARG A N     1 
ATOM   1590 C  CA    . ARG E 3 7  ? 64.885  39.789  135.598 1.00 38.16 ? 325  ARG A CA    1 
ATOM   1591 C  C     . ARG E 3 7  ? 66.030  38.834  135.423 1.00 34.69 ? 325  ARG A C     1 
ATOM   1592 O  O     . ARG E 3 7  ? 65.857  37.656  135.195 1.00 38.77 ? 325  ARG A O     1 
ATOM   1593 C  CB    . ARG E 3 7  ? 64.965  40.831  134.482 1.00 40.24 ? 325  ARG A CB    1 
ATOM   1594 C  CG    . ARG E 3 7  ? 64.466  40.409  133.142 1.00 32.70 ? 325  ARG A CG    1 
ATOM   1595 C  CD    . ARG E 3 7  ? 64.981  41.360  132.080 1.00 43.62 ? 325  ARG A CD    1 
ATOM   1596 N  NE    . ARG E 3 7  ? 66.093  40.739  131.366 1.00 56.34 ? 325  ARG A NE    1 
ATOM   1597 C  CZ    . ARG E 3 7  ? 67.381  41.028  131.540 1.00 66.71 ? 325  ARG A CZ    1 
ATOM   1598 N  NH1   . ARG E 3 7  ? 67.769  41.970  132.403 1.00 65.20 ? 325  ARG A NH1   1 
ATOM   1599 N  NH2   . ARG E 3 7  ? 68.294  40.282  130.923 1.00 63.47 ? 325  ARG A NH2   1 
ATOM   1600 N  N     . THR E 3 8  ? 67.219  39.347  135.586 1.00 29.30 ? 326  THR A N     1 
ATOM   1601 C  CA    . THR E 3 8  ? 68.369  38.530  135.427 1.00 29.65 ? 326  THR A CA    1 
ATOM   1602 C  C     . THR E 3 8  ? 68.346  37.364  136.401 1.00 31.72 ? 326  THR A C     1 
ATOM   1603 O  O     . THR E 3 8  ? 68.719  36.239  136.066 1.00 35.28 ? 326  THR A O     1 
ATOM   1604 C  CB    . THR E 3 8  ? 69.584  39.388  135.651 1.00 35.21 ? 326  THR A CB    1 
ATOM   1605 O  OG1   . THR E 3 8  ? 69.565  40.472  134.702 1.00 44.62 ? 326  THR A OG1   1 
ATOM   1606 C  CG2   . THR E 3 8  ? 70.852  38.574  135.523 1.00 34.71 ? 326  THR A CG2   1 
ATOM   1607 N  N     . ALA E 3 9  ? 67.861  37.617  137.603 1.00 33.85 ? 327  ALA A N     1 
ATOM   1608 C  CA    . ALA E 3 9  ? 67.830  36.569  138.620 1.00 34.07 ? 327  ALA A CA    1 
ATOM   1609 C  C     . ALA E 3 9  ? 66.813  35.516  138.233 1.00 29.48 ? 327  ALA A C     1 
ATOM   1610 O  O     . ALA E 3 9  ? 67.088  34.317  138.226 1.00 29.80 ? 327  ALA A O     1 
ATOM   1611 C  CB    . ALA E 3 9  ? 67.484  37.174  140.013 1.00 31.75 ? 327  ALA A CB    1 
ATOM   1612 N  N     . HIS E 3 10 ? 65.642  35.995  137.863 1.00 25.92 ? 328  HIS A N     1 
ATOM   1613 C  CA    . HIS E 3 10 ? 64.566  35.131  137.491 1.00 28.47 ? 328  HIS A CA    1 
ATOM   1614 C  C     . HIS E 3 10 ? 64.952  34.123  136.428 1.00 34.21 ? 328  HIS A C     1 
ATOM   1615 O  O     . HIS E 3 10 ? 64.553  32.953  136.501 1.00 34.83 ? 328  HIS A O     1 
ATOM   1616 C  CB    . HIS E 3 10 ? 63.394  35.943  137.012 1.00 24.13 ? 328  HIS A CB    1 
ATOM   1617 C  CG    . HIS E 3 10 ? 62.218  35.105  136.646 1.00 31.82 ? 328  HIS A CG    1 
ATOM   1618 N  ND1   . HIS E 3 10 ? 61.788  34.061  137.430 1.00 29.57 ? 328  HIS A ND1   1 
ATOM   1619 C  CD2   . HIS E 3 10 ? 61.399  35.135  135.569 1.00 34.54 ? 328  HIS A CD2   1 
ATOM   1620 C  CE1   . HIS E 3 10 ? 60.752  33.484  136.852 1.00 37.76 ? 328  HIS A CE1   1 
ATOM   1621 N  NE2   . HIS E 3 10 ? 60.494  34.117  135.720 1.00 34.42 ? 328  HIS A NE2   1 
ATOM   1622 N  N     . ASN E 3 11 ? 65.734  34.577  135.451 1.00 35.48 ? 329  ASN A N     1 
ATOM   1623 C  CA    . ASN E 3 11 ? 66.154  33.733  134.355 1.00 28.90 ? 329  ASN A CA    1 
ATOM   1624 C  C     . ASN E 3 11 ? 67.025  32.622  134.882 1.00 30.19 ? 329  ASN A C     1 
ATOM   1625 O  O     . ASN E 3 11 ? 66.908  31.485  134.425 1.00 34.26 ? 329  ASN A O     1 
ATOM   1626 C  CB    . ASN E 3 11 ? 66.879  34.541  133.275 1.00 28.75 ? 329  ASN A CB    1 
ATOM   1627 C  CG    . ASN E 3 11 ? 65.950  35.504  132.518 1.00 26.70 ? 329  ASN A CG    1 
ATOM   1628 O  OD1   . ASN E 3 11 ? 64.714  35.452  132.636 1.00 32.51 ? 329  ASN A OD1   1 
ATOM   1629 N  ND2   . ASN E 3 11 ? 66.552  36.399  131.735 1.00 30.33 ? 329  ASN A ND2   1 
ATOM   1630 N  N     . ALA E 3 12 ? 67.817  32.903  135.908 1.00 27.27 ? 330  ALA A N     1 
ATOM   1631 C  CA    . ALA E 3 12 ? 68.689  31.875  136.481 1.00 25.85 ? 330  ALA A CA    1 
ATOM   1632 C  C     . ALA E 3 12 ? 67.908  30.904  137.361 1.00 31.03 ? 330  ALA A C     1 
ATOM   1633 O  O     . ALA E 3 12 ? 68.282  29.734  137.521 1.00 33.63 ? 330  ALA A O     1 
ATOM   1634 C  CB    . ALA E 3 12 ? 69.755  32.511  137.279 1.00 28.02 ? 330  ALA A CB    1 
ATOM   1635 N  N     . ILE E 3 13 ? 66.853  31.425  137.979 1.00 37.26 ? 331  ILE A N     1 
ATOM   1636 C  CA    . ILE E 3 13 ? 65.948  30.658  138.854 1.00 37.72 ? 331  ILE A CA    1 
ATOM   1637 C  C     . ILE E 3 13 ? 65.181  29.679  137.932 1.00 36.10 ? 331  ILE A C     1 
ATOM   1638 O  O     . ILE E 3 13 ? 65.057  28.476  138.213 1.00 33.80 ? 331  ILE A O     1 
ATOM   1639 C  CB    . ILE E 3 13 ? 64.945  31.645  139.590 1.00 30.31 ? 331  ILE A CB    1 
ATOM   1640 C  CG1   . ILE E 3 13 ? 65.644  32.405  140.696 1.00 21.58 ? 331  ILE A CG1   1 
ATOM   1641 C  CG2   . ILE E 3 13 ? 63.781  30.918  140.217 1.00 36.36 ? 331  ILE A CG2   1 
ATOM   1642 C  CD1   . ILE E 3 13 ? 64.827  33.611  141.136 1.00 25.00 ? 331  ILE A CD1   1 
ATOM   1643 N  N     . GLU E 3 14 ? 64.706  30.221  136.815 1.00 33.17 ? 332  GLU A N     1 
ATOM   1644 C  CA    . GLU E 3 14 ? 63.979  29.471  135.821 1.00 29.97 ? 332  GLU A CA    1 
ATOM   1645 C  C     . GLU E 3 14 ? 64.911  28.453  135.160 1.00 27.45 ? 332  GLU A C     1 
ATOM   1646 O  O     . GLU E 3 14 ? 64.472  27.427  134.646 1.00 30.40 ? 332  GLU A O     1 
ATOM   1647 C  CB    . GLU E 3 14 ? 63.379  30.437  134.798 1.00 33.70 ? 332  GLU A CB    1 
ATOM   1648 C  CG    . GLU E 3 14 ? 62.524  29.776  133.713 1.00 37.74 ? 332  GLU A CG    1 
ATOM   1649 C  CD    . GLU E 3 14 ? 61.225  29.172  134.229 1.00 37.67 ? 332  GLU A CD    1 
ATOM   1650 O  OE1   . GLU E 3 14 ? 60.825  29.464  135.373 1.00 34.92 ? 332  GLU A OE1   1 
ATOM   1651 O  OE2   . GLU E 3 14 ? 60.586  28.416  133.467 1.00 39.82 ? 332  GLU A OE2   1 
ATOM   1652 N  N     . LYS E 3 15 ? 66.204  28.707  135.192 1.00 25.77 ? 333  LYS A N     1 
ATOM   1653 C  CA    . LYS E 3 15 ? 67.109  27.756  134.600 1.00 27.03 ? 333  LYS A CA    1 
ATOM   1654 C  C     . LYS E 3 15 ? 67.126  26.570  135.535 1.00 29.10 ? 333  LYS A C     1 
ATOM   1655 O  O     . LYS E 3 15 ? 67.087  25.422  135.102 1.00 31.78 ? 333  LYS A O     1 
ATOM   1656 C  CB    . LYS E 3 15 ? 68.510  28.329  134.458 1.00 29.04 ? 333  LYS A CB    1 
ATOM   1657 C  CG    . LYS E 3 15 ? 69.411  27.424  133.645 1.00 33.88 ? 333  LYS A CG    1 
ATOM   1658 C  CD    . LYS E 3 15 ? 70.825  27.436  134.175 1.00 40.28 ? 333  LYS A CD    1 
ATOM   1659 C  CE    . LYS E 3 15 ? 71.740  26.572  133.314 1.00 50.69 ? 333  LYS A CE    1 
ATOM   1660 N  NZ    . LYS E 3 15 ? 71.283  25.133  133.269 1.00 66.27 ? 333  LYS A NZ    1 
ATOM   1661 N  N     . ARG E 3 16 ? 67.219  26.871  136.826 1.00 32.07 ? 334  ARG A N     1 
ATOM   1662 C  CA    . ARG E 3 16 ? 67.209  25.870  137.895 1.00 34.15 ? 334  ARG A CA    1 
ATOM   1663 C  C     . ARG E 3 16 ? 65.889  25.074  137.882 1.00 28.97 ? 334  ARG A C     1 
ATOM   1664 O  O     . ARG E 3 16 ? 65.889  23.858  138.068 1.00 34.59 ? 334  ARG A O     1 
ATOM   1665 C  CB    . ARG E 3 16 ? 67.417  26.581  139.238 1.00 40.47 ? 334  ARG A CB    1 
ATOM   1666 C  CG    . ARG E 3 16 ? 67.052  25.780  140.493 1.00 51.67 ? 334  ARG A CG    1 
ATOM   1667 C  CD    . ARG E 3 16 ? 67.645  26.409  141.767 1.00 50.72 ? 334  ARG A CD    1 
ATOM   1668 N  NE    . ARG E 3 16 ? 67.234  27.800  141.967 1.00 50.55 ? 334  ARG A NE    1 
ATOM   1669 C  CZ    . ARG E 3 16 ? 68.007  28.862  141.738 1.00 49.29 ? 334  ARG A CZ    1 
ATOM   1670 N  NH1   . ARG E 3 16 ? 69.240  28.714  141.263 1.00 44.03 ? 334  ARG A NH1   1 
ATOM   1671 N  NH2   . ARG E 3 16 ? 67.530  30.082  141.964 1.00 49.89 ? 334  ARG A NH2   1 
ATOM   1672 N  N     . TYR E 3 17 ? 64.786  25.771  137.636 1.00 25.29 ? 335  TYR A N     1 
ATOM   1673 C  CA    . TYR E 3 17 ? 63.448  25.188  137.554 1.00 27.27 ? 335  TYR A CA    1 
ATOM   1674 C  C     . TYR E 3 17 ? 63.403  24.121  136.478 1.00 28.35 ? 335  TYR A C     1 
ATOM   1675 O  O     . TYR E 3 17 ? 63.051  22.985  136.744 1.00 36.23 ? 335  TYR A O     1 
ATOM   1676 C  CB    . TYR E 3 17 ? 62.428  26.264  137.184 1.00 25.40 ? 335  TYR A CB    1 
ATOM   1677 C  CG    . TYR E 3 17 ? 61.058  25.709  136.947 1.00 25.07 ? 335  TYR A CG    1 
ATOM   1678 C  CD1   . TYR E 3 17 ? 60.390  25.040  137.959 1.00 32.57 ? 335  TYR A CD1   1 
ATOM   1679 C  CD2   . TYR E 3 17 ? 60.426  25.840  135.730 1.00 22.39 ? 335  TYR A CD2   1 
ATOM   1680 C  CE1   . TYR E 3 17 ? 59.132  24.519  137.761 1.00 29.42 ? 335  TYR A CE1   1 
ATOM   1681 C  CE2   . TYR E 3 17 ? 59.157  25.319  135.530 1.00 23.23 ? 335  TYR A CE2   1 
ATOM   1682 C  CZ    . TYR E 3 17 ? 58.524  24.659  136.551 1.00 23.95 ? 335  TYR A CZ    1 
ATOM   1683 O  OH    . TYR E 3 17 ? 57.276  24.119  136.394 1.00 25.31 ? 335  TYR A OH    1 
ATOM   1684 N  N     . ARG E 3 18 ? 63.711  24.514  135.251 1.00 29.64 ? 336  ARG A N     1 
ATOM   1685 C  CA    . ARG E 3 18 ? 63.746  23.602  134.117 1.00 28.93 ? 336  ARG A CA    1 
ATOM   1686 C  C     . ARG E 3 18 ? 64.567  22.367  134.386 1.00 25.80 ? 336  ARG A C     1 
ATOM   1687 O  O     . ARG E 3 18 ? 64.190  21.261  133.996 1.00 30.84 ? 336  ARG A O     1 
ATOM   1688 C  CB    . ARG E 3 18 ? 64.373  24.282  132.918 1.00 26.90 ? 336  ARG A CB    1 
ATOM   1689 C  CG    . ARG E 3 18 ? 63.468  25.167  132.168 1.00 29.40 ? 336  ARG A CG    1 
ATOM   1690 C  CD    . ARG E 3 18 ? 64.241  25.806  131.034 1.00 32.83 ? 336  ARG A CD    1 
ATOM   1691 N  NE    . ARG E 3 18 ? 63.852  27.197  130.970 1.00 36.95 ? 336  ARG A NE    1 
ATOM   1692 C  CZ    . ARG E 3 18 ? 64.712  28.195  131.004 1.00 33.24 ? 336  ARG A CZ    1 
ATOM   1693 N  NH1   . ARG E 3 18 ? 66.013  27.948  131.071 1.00 26.00 ? 336  ARG A NH1   1 
ATOM   1694 N  NH2   . ARG E 3 18 ? 64.254  29.436  131.059 1.00 37.58 ? 336  ARG A NH2   1 
ATOM   1695 N  N     . SER E 3 19 ? 65.737  22.571  134.963 1.00 23.77 ? 337  SER A N     1 
ATOM   1696 C  CA    . SER E 3 19 ? 66.620  21.470  135.271 1.00 26.24 ? 337  SER A CA    1 
ATOM   1697 C  C     . SER E 3 19 ? 65.987  20.521  136.283 1.00 29.06 ? 337  SER A C     1 
ATOM   1698 O  O     . SER E 3 19 ? 66.158  19.305  136.170 1.00 29.08 ? 337  SER A O     1 
ATOM   1699 C  CB    . SER E 3 19 ? 67.934  22.002  135.828 1.00 31.00 ? 337  SER A CB    1 
ATOM   1700 O  OG    . SER E 3 19 ? 68.447  23.059  135.025 1.00 50.31 ? 337  SER A OG    1 
ATOM   1701 N  N     . SER E 3 20 ? 65.222  21.071  137.235 1.00 28.67 ? 338  SER A N     1 
ATOM   1702 C  CA    . SER E 3 20 ? 64.584  20.264  138.279 1.00 26.98 ? 338  SER A CA    1 
ATOM   1703 C  C     . SER E 3 20 ? 63.567  19.311  137.695 1.00 28.65 ? 338  SER A C     1 
ATOM   1704 O  O     . SER E 3 20 ? 63.165  18.354  138.330 1.00 34.80 ? 338  SER A O     1 
ATOM   1705 C  CB    . SER E 3 20 ? 63.908  21.137  139.330 1.00 27.53 ? 338  SER A CB    1 
ATOM   1706 O  OG    . SER E 3 20 ? 62.723  21.754  138.859 1.00 24.33 ? 338  SER A OG    1 
ATOM   1707 N  N     . ILE E 3 21 ? 63.130  19.609  136.484 1.00 29.52 ? 339  ILE A N     1 
ATOM   1708 C  CA    . ILE E 3 21 ? 62.165  18.797  135.783 1.00 24.68 ? 339  ILE A CA    1 
ATOM   1709 C  C     . ILE E 3 21 ? 62.860  17.937  134.734 1.00 29.68 ? 339  ILE A C     1 
ATOM   1710 O  O     . ILE E 3 21 ? 62.724  16.700  134.730 1.00 29.78 ? 339  ILE A O     1 
ATOM   1711 C  CB    . ILE E 3 21 ? 61.121  19.699  135.112 1.00 22.95 ? 339  ILE A CB    1 
ATOM   1712 C  CG1   . ILE E 3 21 ? 60.265  20.348  136.188 1.00 18.51 ? 339  ILE A CG1   1 
ATOM   1713 C  CG2   . ILE E 3 21 ? 60.299  18.918  134.072 1.00 27.16 ? 339  ILE A CG2   1 
ATOM   1714 C  CD1   . ILE E 3 21 ? 59.018  20.935  135.692 1.00 17.96 ? 339  ILE A CD1   1 
ATOM   1715 N  N     . ASN E 3 22 ? 63.649  18.590  133.880 1.00 28.37 ? 340  ASN A N     1 
ATOM   1716 C  CA    . ASN E 3 22 ? 64.343  17.903  132.799 1.00 22.08 ? 340  ASN A CA    1 
ATOM   1717 C  C     . ASN E 3 22 ? 65.306  16.879  133.326 1.00 22.19 ? 340  ASN A C     1 
ATOM   1718 O  O     . ASN E 3 22 ? 65.394  15.784  132.802 1.00 27.88 ? 340  ASN A O     1 
ATOM   1719 C  CB    . ASN E 3 22 ? 65.044  18.889  131.865 1.00 14.75 ? 340  ASN A CB    1 
ATOM   1720 C  CG    . ASN E 3 22 ? 64.076  19.756  131.080 1.00 20.13 ? 340  ASN A CG    1 
ATOM   1721 O  OD1   . ASN E 3 22 ? 62.943  19.367  130.736 1.00 24.95 ? 340  ASN A OD1   1 
ATOM   1722 N  ND2   . ASN E 3 22 ? 64.520  20.950  130.775 1.00 30.75 ? 340  ASN A ND2   1 
ATOM   1723 N  N     . ASP E 3 23 ? 65.997  17.201  134.405 1.00 29.83 ? 341  ASP A N     1 
ATOM   1724 C  CA    . ASP E 3 23 ? 66.945  16.257  134.972 1.00 31.40 ? 341  ASP A CA    1 
ATOM   1725 C  C     . ASP E 3 23 ? 66.258  14.987  135.431 1.00 29.50 ? 341  ASP A C     1 
ATOM   1726 O  O     . ASP E 3 23 ? 66.828  13.898  135.358 1.00 29.55 ? 341  ASP A O     1 
ATOM   1727 C  CB    . ASP E 3 23 ? 67.684  16.901  136.126 1.00 38.06 ? 341  ASP A CB    1 
ATOM   1728 C  CG    . ASP E 3 23 ? 68.643  17.981  135.667 1.00 50.06 ? 341  ASP A CG    1 
ATOM   1729 O  OD1   . ASP E 3 23 ? 68.868  18.088  134.433 1.00 57.25 ? 341  ASP A OD1   1 
ATOM   1730 O  OD2   . ASP E 3 23 ? 69.178  18.717  136.540 1.00 59.66 ? 341  ASP A OD2   1 
ATOM   1731 N  N     . LYS E 3 24 ? 65.010  15.139  135.864 1.00 29.88 ? 342  LYS A N     1 
ATOM   1732 C  CA    . LYS E 3 24 ? 64.201  14.023  136.331 1.00 27.92 ? 342  LYS A CA    1 
ATOM   1733 C  C     . LYS E 3 24 ? 63.576  13.260  135.189 1.00 27.74 ? 342  LYS A C     1 
ATOM   1734 O  O     . LYS E 3 24 ? 63.398  12.044  135.278 1.00 31.62 ? 342  LYS A O     1 
ATOM   1735 C  CB    . LYS E 3 24 ? 63.129  14.491  137.307 1.00 26.37 ? 342  LYS A CB    1 
ATOM   1736 C  CG    . LYS E 3 24 ? 63.664  14.642  138.692 1.00 22.55 ? 342  LYS A CG    1 
ATOM   1737 C  CD    . LYS E 3 24 ? 62.678  15.344  139.560 1.00 21.39 ? 342  LYS A CD    1 
ATOM   1738 C  CE    . LYS E 3 24 ? 63.392  15.865  140.775 1.00 24.11 ? 342  LYS A CE    1 
ATOM   1739 N  NZ    . LYS E 3 24 ? 64.004  17.200  140.539 1.00 20.47 ? 342  LYS A NZ    1 
ATOM   1740 N  N     . ILE E 3 25 ? 63.219  13.958  134.119 1.00 27.22 ? 343  ILE A N     1 
ATOM   1741 C  CA    . ILE E 3 25 ? 62.652  13.257  132.990 1.00 26.09 ? 343  ILE A CA    1 
ATOM   1742 C  C     . ILE E 3 25 ? 63.753  12.367  132.386 1.00 28.83 ? 343  ILE A C     1 
ATOM   1743 O  O     . ILE E 3 25 ? 63.461  11.294  131.855 1.00 31.20 ? 343  ILE A O     1 
ATOM   1744 C  CB    . ILE E 3 25 ? 62.043  14.224  131.967 1.00 24.45 ? 343  ILE A CB    1 
ATOM   1745 C  CG1   . ILE E 3 25 ? 60.860  14.943  132.609 1.00 17.23 ? 343  ILE A CG1   1 
ATOM   1746 C  CG2   . ILE E 3 25 ? 61.626  13.480  130.704 1.00 17.34 ? 343  ILE A CG2   1 
ATOM   1747 C  CD1   . ILE E 3 25 ? 60.274  16.038  131.747 1.00 18.99 ? 343  ILE A CD1   1 
ATOM   1748 N  N     . ILE E 3 26 ? 65.021  12.751  132.533 1.00 26.72 ? 344  ILE A N     1 
ATOM   1749 C  CA    . ILE E 3 26 ? 66.070  11.900  131.987 1.00 33.20 ? 344  ILE A CA    1 
ATOM   1750 C  C     . ILE E 3 26 ? 66.398  10.720  132.916 1.00 33.35 ? 344  ILE A C     1 
ATOM   1751 O  O     . ILE E 3 26 ? 66.855  9.670   132.448 1.00 36.06 ? 344  ILE A O     1 
ATOM   1752 C  CB    . ILE E 3 26 ? 67.320  12.688  131.462 1.00 32.14 ? 344  ILE A CB    1 
ATOM   1753 C  CG1   . ILE E 3 26 ? 68.186  13.209  132.576 1.00 44.94 ? 344  ILE A CG1   1 
ATOM   1754 C  CG2   . ILE E 3 26 ? 66.872  13.890  130.657 1.00 36.89 ? 344  ILE A CG2   1 
ATOM   1755 C  CD1   . ILE E 3 26 ? 69.024  14.441  132.146 1.00 51.37 ? 344  ILE A CD1   1 
ATOM   1756 N  N     . GLU E 3 27 ? 66.092  10.874  134.211 1.00 33.70 ? 345  GLU A N     1 
ATOM   1757 C  CA    . GLU E 3 27 ? 66.274  9.816   135.220 1.00 27.99 ? 345  GLU A CA    1 
ATOM   1758 C  C     . GLU E 3 27 ? 65.205  8.785   134.904 1.00 24.58 ? 345  GLU A C     1 
ATOM   1759 O  O     . GLU E 3 27 ? 65.444  7.592   134.984 1.00 30.95 ? 345  GLU A O     1 
ATOM   1760 C  CB    . GLU E 3 27 ? 66.036  10.359  136.620 1.00 29.25 ? 345  GLU A CB    1 
ATOM   1761 C  CG    . GLU E 3 27 ? 67.162  10.089  137.560 1.00 37.15 ? 345  GLU A CG    1 
ATOM   1762 C  CD    . GLU E 3 27 ? 67.042  10.819  138.890 1.00 46.66 ? 345  GLU A CD    1 
ATOM   1763 O  OE1   . GLU E 3 27 ? 66.718  12.041  138.916 1.00 48.98 ? 345  GLU A OE1   1 
ATOM   1764 O  OE2   . GLU E 3 27 ? 67.323  10.168  139.926 1.00 61.87 ? 345  GLU A OE2   1 
ATOM   1765 N  N     . LEU E 3 28 ? 64.027  9.256   134.515 1.00 22.38 ? 346  LEU A N     1 
ATOM   1766 C  CA    . LEU E 3 28 ? 62.925  8.385   134.119 1.00 22.77 ? 346  LEU A CA    1 
ATOM   1767 C  C     . LEU E 3 28 ? 63.235  7.727   132.790 1.00 23.64 ? 346  LEU A C     1 
ATOM   1768 O  O     . LEU E 3 28 ? 62.929  6.567   132.593 1.00 25.73 ? 346  LEU A O     1 
ATOM   1769 C  CB    . LEU E 3 28 ? 61.622  9.172   133.992 1.00 19.15 ? 346  LEU A CB    1 
ATOM   1770 C  CG    . LEU E 3 28 ? 60.969  9.492   135.330 1.00 18.42 ? 346  LEU A CG    1 
ATOM   1771 C  CD1   . LEU E 3 28 ? 59.801  10.416  135.117 1.00 16.51 ? 346  LEU A CD1   1 
ATOM   1772 C  CD2   . LEU E 3 28 ? 60.541  8.193   135.996 1.00 13.57 ? 346  LEU A CD2   1 
ATOM   1773 N  N     . LYS E 3 29 ? 63.823  8.476   131.865 1.00 26.61 ? 347  LYS A N     1 
ATOM   1774 C  CA    . LYS E 3 29 ? 64.180  7.925   130.571 1.00 25.86 ? 347  LYS A CA    1 
ATOM   1775 C  C     . LYS E 3 29 ? 65.096  6.731   130.791 1.00 27.51 ? 347  LYS A C     1 
ATOM   1776 O  O     . LYS E 3 29 ? 64.838  5.629   130.311 1.00 35.85 ? 347  LYS A O     1 
ATOM   1777 C  CB    . LYS E 3 29 ? 64.894  8.967   129.720 1.00 28.20 ? 347  LYS A CB    1 
ATOM   1778 C  CG    . LYS E 3 29 ? 65.074  8.537   128.255 1.00 28.05 ? 347  LYS A CG    1 
ATOM   1779 C  CD    . LYS E 3 29 ? 66.463  8.848   127.762 1.00 27.90 ? 347  LYS A CD    1 
ATOM   1780 C  CE    . LYS E 3 29 ? 67.407  7.759   128.168 1.00 31.49 ? 347  LYS A CE    1 
ATOM   1781 N  NZ    . LYS E 3 29 ? 68.818  8.218   128.207 1.00 34.81 ? 347  LYS A NZ    1 
ATOM   1782 N  N     . ASP E 3 30 ? 66.147  6.940   131.556 1.00 25.87 ? 348  ASP A N     1 
ATOM   1783 C  CA    . ASP E 3 30 ? 67.076  5.880   131.841 1.00 28.48 ? 348  ASP A CA    1 
ATOM   1784 C  C     . ASP E 3 30 ? 66.423  4.658   132.480 1.00 30.54 ? 348  ASP A C     1 
ATOM   1785 O  O     . ASP E 3 30 ? 66.895  3.535   132.313 1.00 35.70 ? 348  ASP A O     1 
ATOM   1786 C  CB    . ASP E 3 30 ? 68.181  6.403   132.737 1.00 33.44 ? 348  ASP A CB    1 
ATOM   1787 C  CG    . ASP E 3 30 ? 69.107  7.388   132.021 1.00 46.19 ? 348  ASP A CG    1 
ATOM   1788 O  OD1   . ASP E 3 30 ? 69.072  7.458   130.767 1.00 49.06 ? 348  ASP A OD1   1 
ATOM   1789 O  OD2   . ASP E 3 30 ? 69.898  8.081   132.724 1.00 53.79 ? 348  ASP A OD2   1 
ATOM   1790 N  N     . LEU E 3 31 ? 65.347  4.864   133.226 1.00 32.87 ? 349  LEU A N     1 
ATOM   1791 C  CA    . LEU E 3 31 ? 64.659  3.745   133.881 1.00 30.85 ? 349  LEU A CA    1 
ATOM   1792 C  C     . LEU E 3 31 ? 63.780  2.963   132.932 1.00 28.99 ? 349  LEU A C     1 
ATOM   1793 O  O     . LEU E 3 31 ? 63.636  1.766   133.091 1.00 31.53 ? 349  LEU A O     1 
ATOM   1794 C  CB    . LEU E 3 31 ? 63.793  4.242   135.046 1.00 31.86 ? 349  LEU A CB    1 
ATOM   1795 C  CG    . LEU E 3 31 ? 64.497  4.496   136.371 1.00 26.94 ? 349  LEU A CG    1 
ATOM   1796 C  CD1   . LEU E 3 31 ? 63.740  5.452   137.249 1.00 21.60 ? 349  LEU A CD1   1 
ATOM   1797 C  CD2   . LEU E 3 31 ? 64.663  3.169   137.043 1.00 37.20 ? 349  LEU A CD2   1 
ATOM   1798 N  N     . VAL E 3 32 ? 63.176  3.644   131.960 1.00 30.50 ? 350  VAL A N     1 
ATOM   1799 C  CA    . VAL E 3 32 ? 62.279  2.996   131.019 1.00 27.29 ? 350  VAL A CA    1 
ATOM   1800 C  C     . VAL E 3 32 ? 62.921  2.497   129.737 1.00 32.95 ? 350  VAL A C     1 
ATOM   1801 O  O     . VAL E 3 32 ? 62.461  1.497   129.178 1.00 36.14 ? 350  VAL A O     1 
ATOM   1802 C  CB    . VAL E 3 32 ? 61.054  3.879   130.681 1.00 24.39 ? 350  VAL A CB    1 
ATOM   1803 C  CG1   . VAL E 3 32 ? 60.227  4.110   131.935 1.00 27.55 ? 350  VAL A CG1   1 
ATOM   1804 C  CG2   . VAL E 3 32 ? 61.471  5.200   130.049 1.00 16.68 ? 350  VAL A CG2   1 
ATOM   1805 N  N     . VAL E 3 33 ? 63.957  3.183   129.258 1.00 29.00 ? 351  VAL A N     1 
ATOM   1806 C  CA    . VAL E 3 33 ? 64.625  2.758   128.033 1.00 30.96 ? 351  VAL A CA    1 
ATOM   1807 C  C     . VAL E 3 33 ? 66.136  2.626   128.123 1.00 31.82 ? 351  VAL A C     1 
ATOM   1808 O  O     . VAL E 3 33 ? 66.781  2.142   127.187 1.00 38.93 ? 351  VAL A O     1 
ATOM   1809 C  CB    . VAL E 3 33 ? 64.261  3.639   126.805 1.00 26.25 ? 351  VAL A CB    1 
ATOM   1810 C  CG1   . VAL E 3 33 ? 62.827  3.397   126.381 1.00 24.60 ? 351  VAL A CG1   1 
ATOM   1811 C  CG2   . VAL E 3 33 ? 64.491  5.090   127.102 1.00 28.28 ? 351  VAL A CG2   1 
ATOM   1812 N  N     . GLY E 3 34 ? 66.717  3.069   129.225 1.00 35.42 ? 352  GLY A N     1 
ATOM   1813 C  CA    . GLY E 3 34 ? 68.151  2.929   129.368 1.00 30.98 ? 352  GLY A CA    1 
ATOM   1814 C  C     . GLY E 3 34 ? 68.973  4.184   129.218 1.00 33.42 ? 352  GLY A C     1 
ATOM   1815 O  O     . GLY E 3 34 ? 68.587  5.156   128.583 1.00 33.59 ? 352  GLY A O     1 
ATOM   1816 N  N     . THR E 3 35 ? 70.158  4.119   129.798 1.00 38.48 ? 353  THR A N     1 
ATOM   1817 C  CA    . THR E 3 35 ? 71.086  5.217   129.783 1.00 42.13 ? 353  THR A CA    1 
ATOM   1818 C  C     . THR E 3 35 ? 71.377  5.663   128.341 1.00 48.87 ? 353  THR A C     1 
ATOM   1819 O  O     . THR E 3 35 ? 71.210  6.840   128.001 1.00 54.83 ? 353  THR A O     1 
ATOM   1820 C  CB    . THR E 3 35 ? 72.368  4.798   130.503 1.00 31.30 ? 353  THR A CB    1 
ATOM   1821 N  N     . GLU E 3 36 ? 71.704  4.694   127.480 1.00 53.38 ? 354  GLU A N     1 
ATOM   1822 C  CA    . GLU E 3 36 ? 72.080  4.941   126.080 1.00 51.11 ? 354  GLU A CA    1 
ATOM   1823 C  C     . GLU E 3 36 ? 71.002  5.382   125.106 1.00 47.71 ? 354  GLU A C     1 
ATOM   1824 O  O     . GLU E 3 36 ? 71.270  6.193   124.221 1.00 49.17 ? 354  GLU A O     1 
ATOM   1825 C  CB    . GLU E 3 36 ? 72.836  3.731   125.519 1.00 52.96 ? 354  GLU A CB    1 
ATOM   1826 N  N     . ALA E 3 37 ? 69.800  4.837   125.239 1.00 46.60 ? 355  ALA A N     1 
ATOM   1827 C  CA    . ALA E 3 37 ? 68.702  5.203   124.343 1.00 45.59 ? 355  ALA A CA    1 
ATOM   1828 C  C     . ALA E 3 37 ? 68.291  6.681   124.453 1.00 45.09 ? 355  ALA A C     1 
ATOM   1829 O  O     . ALA E 3 37 ? 68.569  7.349   125.446 1.00 48.80 ? 355  ALA A O     1 
ATOM   1830 C  CB    . ALA E 3 37 ? 67.505  4.318   124.601 1.00 42.40 ? 355  ALA A CB    1 
ATOM   1831 N  N     . LYS E 3 38 ? 67.670  7.206   123.412 1.00 38.45 ? 356  LYS A N     1 
ATOM   1832 C  CA    . LYS E 3 38 ? 67.214  8.576   123.452 1.00 36.72 ? 356  LYS A CA    1 
ATOM   1833 C  C     . LYS E 3 38 ? 65.759  8.461   123.077 1.00 37.41 ? 356  LYS A C     1 
ATOM   1834 O  O     . LYS E 3 38 ? 65.425  7.736   122.138 1.00 40.64 ? 356  LYS A O     1 
ATOM   1835 C  CB    . LYS E 3 38 ? 67.957  9.428   122.452 1.00 29.86 ? 356  LYS A CB    1 
ATOM   1836 N  N     . LEU E 3 39 ? 64.894  9.090   123.871 1.00 34.00 ? 357  LEU A N     1 
ATOM   1837 C  CA    . LEU E 3 39 ? 63.455  9.088   123.637 1.00 26.58 ? 357  LEU A CA    1 
ATOM   1838 C  C     . LEU E 3 39 ? 63.011  10.469  124.081 1.00 29.57 ? 357  LEU A C     1 
ATOM   1839 O  O     . LEU E 3 39 ? 63.656  11.070  124.938 1.00 34.58 ? 357  LEU A O     1 
ATOM   1840 C  CB    . LEU E 3 39 ? 62.781  8.007   124.478 1.00 28.10 ? 357  LEU A CB    1 
ATOM   1841 C  CG    . LEU E 3 39 ? 61.258  7.963   124.431 1.00 31.86 ? 357  LEU A CG    1 
ATOM   1842 C  CD1   . LEU E 3 39 ? 60.774  7.652   123.025 1.00 33.60 ? 357  LEU A CD1   1 
ATOM   1843 C  CD2   . LEU E 3 39 ? 60.751  6.949   125.402 1.00 29.09 ? 357  LEU A CD2   1 
ATOM   1844 N  N     . ASN E 3 40 ? 61.971  11.006  123.452 1.00 29.56 ? 358  ASN A N     1 
ATOM   1845 C  CA    . ASN E 3 40 ? 61.462  12.328  123.777 1.00 25.56 ? 358  ASN A CA    1 
ATOM   1846 C  C     . ASN E 3 40 ? 60.690  12.363  125.102 1.00 25.33 ? 358  ASN A C     1 
ATOM   1847 O  O     . ASN E 3 40 ? 60.101  11.378  125.508 1.00 28.25 ? 358  ASN A O     1 
ATOM   1848 C  CB    . ASN E 3 40 ? 60.562  12.832  122.654 1.00 29.77 ? 358  ASN A CB    1 
ATOM   1849 C  CG    . ASN E 3 40 ? 59.398  11.916  122.406 1.00 27.62 ? 358  ASN A CG    1 
ATOM   1850 O  OD1   . ASN E 3 40 ? 59.593  10.740  122.116 1.00 37.69 ? 358  ASN A OD1   1 
ATOM   1851 N  ND2   . ASN E 3 40 ? 58.187  12.424  122.544 1.00 24.55 ? 358  ASN A ND2   1 
ATOM   1852 N  N     . LYS E 3 41 ? 60.577  13.553  125.674 1.00 26.23 ? 359  LYS A N     1 
ATOM   1853 C  CA    . LYS E 3 41 ? 59.922  13.778  126.952 1.00 20.66 ? 359  LYS A CA    1 
ATOM   1854 C  C     . LYS E 3 41 ? 58.562  13.151  127.178 1.00 25.56 ? 359  LYS A C     1 
ATOM   1855 O  O     . LYS E 3 41 ? 58.375  12.445  128.174 1.00 31.06 ? 359  LYS A O     1 
ATOM   1856 C  CB    . LYS E 3 41 ? 59.840  15.273  127.256 1.00 22.80 ? 359  LYS A CB    1 
ATOM   1857 C  CG    . LYS E 3 41 ? 61.190  15.943  127.360 1.00 16.84 ? 359  LYS A CG    1 
ATOM   1858 C  CD    . LYS E 3 41 ? 61.110  17.447  127.519 1.00 19.25 ? 359  LYS A CD    1 
ATOM   1859 C  CE    . LYS E 3 41 ? 62.509  17.967  127.681 1.00 17.59 ? 359  LYS A CE    1 
ATOM   1860 N  NZ    . LYS E 3 41 ? 62.460  19.368  128.075 1.00 20.26 ? 359  LYS A NZ    1 
ATOM   1861 N  N     . SER E 3 42 ? 57.601  13.394  126.298 1.00 21.82 ? 360  SER A N     1 
ATOM   1862 C  CA    . SER E 3 42 ? 56.266  12.825  126.528 1.00 23.62 ? 360  SER A CA    1 
ATOM   1863 C  C     . SER E 3 42 ? 56.183  11.292  126.440 1.00 29.63 ? 360  SER A C     1 
ATOM   1864 O  O     . SER E 3 42 ? 55.342  10.654  127.127 1.00 32.88 ? 360  SER A O     1 
ATOM   1865 C  CB    . SER E 3 42 ? 55.205  13.486  125.636 1.00 21.53 ? 360  SER A CB    1 
ATOM   1866 O  OG    . SER E 3 42 ? 55.616  13.499  124.287 1.00 24.95 ? 360  SER A OG    1 
ATOM   1867 N  N     . ALA E 3 43 ? 57.087  10.709  125.654 1.00 23.17 ? 361  ALA A N     1 
ATOM   1868 C  CA    . ALA E 3 43 ? 57.119  9.274   125.452 1.00 24.72 ? 361  ALA A CA    1 
ATOM   1869 C  C     . ALA E 3 43 ? 57.799  8.630   126.628 1.00 20.71 ? 361  ALA A C     1 
ATOM   1870 O  O     . ALA E 3 43 ? 57.554  7.482   126.934 1.00 28.38 ? 361  ALA A O     1 
ATOM   1871 C  CB    . ALA E 3 43 ? 57.835  8.938   124.169 1.00 23.89 ? 361  ALA A CB    1 
ATOM   1872 N  N     . VAL E 3 44 ? 58.714  9.361   127.236 1.00 23.98 ? 362  VAL A N     1 
ATOM   1873 C  CA    . VAL E 3 44 ? 59.403  8.899   128.427 1.00 22.96 ? 362  VAL A CA    1 
ATOM   1874 C  C     . VAL E 3 44 ? 58.366  8.837   129.554 1.00 21.19 ? 362  VAL A C     1 
ATOM   1875 O  O     . VAL E 3 44 ? 58.245  7.816   130.217 1.00 26.49 ? 362  VAL A O     1 
ATOM   1876 C  CB    . VAL E 3 44 ? 60.525  9.869   128.826 1.00 23.53 ? 362  VAL A CB    1 
ATOM   1877 C  CG1   . VAL E 3 44 ? 60.943  9.650   130.265 1.00 23.67 ? 362  VAL A CG1   1 
ATOM   1878 C  CG2   . VAL E 3 44 ? 61.689  9.645   127.936 1.00 26.20 ? 362  VAL A CG2   1 
ATOM   1879 N  N     . LEU E 3 45 ? 57.564  9.890   129.707 1.00 18.59 ? 363  LEU A N     1 
ATOM   1880 C  CA    . LEU E 3 45 ? 56.558  9.919   130.754 1.00 13.14 ? 363  LEU A CA    1 
ATOM   1881 C  C     . LEU E 3 45 ? 55.479  8.897   130.497 1.00 13.42 ? 363  LEU A C     1 
ATOM   1882 O  O     . LEU E 3 45 ? 55.011  8.253   131.404 1.00 26.02 ? 363  LEU A O     1 
ATOM   1883 C  CB    . LEU E 3 45 ? 55.958  11.298  130.890 1.00 14.27 ? 363  LEU A CB    1 
ATOM   1884 C  CG    . LEU E 3 45 ? 56.974  12.406  131.116 1.00 13.09 ? 363  LEU A CG    1 
ATOM   1885 C  CD1   . LEU E 3 45 ? 56.306  13.759  131.122 1.00 15.42 ? 363  LEU A CD1   1 
ATOM   1886 C  CD2   . LEU E 3 45 ? 57.670  12.169  132.408 1.00 14.06 ? 363  LEU A CD2   1 
ATOM   1887 N  N     . ARG E 3 46 ? 55.063  8.737   129.262 1.00 20.03 ? 364  ARG A N     1 
ATOM   1888 C  CA    . ARG E 3 46 ? 54.054  7.743   128.947 1.00 17.96 ? 364  ARG A CA    1 
ATOM   1889 C  C     . ARG E 3 46 ? 54.557  6.362   129.364 1.00 20.85 ? 364  ARG A C     1 
ATOM   1890 O  O     . ARG E 3 46 ? 53.788  5.530   129.830 1.00 23.76 ? 364  ARG A O     1 
ATOM   1891 C  CB    . ARG E 3 46 ? 53.814  7.753   127.446 1.00 20.56 ? 364  ARG A CB    1 
ATOM   1892 C  CG    . ARG E 3 46 ? 53.116  6.537   126.906 1.00 23.06 ? 364  ARG A CG    1 
ATOM   1893 C  CD    . ARG E 3 46 ? 51.653  6.617   127.146 1.00 30.74 ? 364  ARG A CD    1 
ATOM   1894 N  NE    . ARG E 3 46 ? 51.261  6.275   128.510 1.00 41.45 ? 364  ARG A NE    1 
ATOM   1895 C  CZ    . ARG E 3 46 ? 50.384  6.983   129.222 1.00 47.07 ? 364  ARG A CZ    1 
ATOM   1896 N  NH1   . ARG E 3 46 ? 49.842  8.093   128.713 1.00 48.53 ? 364  ARG A NH1   1 
ATOM   1897 N  NH2   . ARG E 3 46 ? 49.919  6.493   130.365 1.00 45.44 ? 364  ARG A NH2   1 
ATOM   1898 N  N     . LYS E 3 47 ? 55.846  6.115   129.123 1.00 23.84 ? 365  LYS A N     1 
ATOM   1899 C  CA    . LYS E 3 47 ? 56.495  4.848   129.444 1.00 22.06 ? 365  LYS A CA    1 
ATOM   1900 C  C     . LYS E 3 47 ? 56.605  4.644   130.932 1.00 21.75 ? 365  LYS A C     1 
ATOM   1901 O  O     . LYS E 3 47 ? 56.400  3.542   131.409 1.00 27.56 ? 365  LYS A O     1 
ATOM   1902 C  CB    . LYS E 3 47 ? 57.887  4.779   128.808 1.00 25.41 ? 365  LYS A CB    1 
ATOM   1903 C  CG    . LYS E 3 47 ? 57.876  4.565   127.290 1.00 22.89 ? 365  LYS A CG    1 
ATOM   1904 C  CD    . LYS E 3 47 ? 59.233  4.125   126.793 1.00 25.73 ? 365  LYS A CD    1 
ATOM   1905 C  CE    . LYS E 3 47 ? 59.232  3.800   125.293 1.00 31.64 ? 365  LYS A CE    1 
ATOM   1906 N  NZ    . LYS E 3 47 ? 58.499  2.556   124.882 1.00 39.18 ? 365  LYS A NZ    1 
ATOM   1907 N  N     . ALA E 3 48 ? 56.962  5.714   131.646 1.00 23.80 ? 366  ALA A N     1 
ATOM   1908 C  CA    . ALA E 3 48 ? 57.079  5.734   133.111 1.00 20.44 ? 366  ALA A CA    1 
ATOM   1909 C  C     . ALA E 3 48 ? 55.746  5.312   133.736 1.00 20.99 ? 366  ALA A C     1 
ATOM   1910 O  O     . ALA E 3 48 ? 55.709  4.431   134.591 1.00 30.31 ? 366  ALA A O     1 
ATOM   1911 C  CB    . ALA E 3 48 ? 57.448  7.124   133.579 1.00 12.24 ? 366  ALA A CB    1 
ATOM   1912 N  N     . ILE E 3 49 ? 54.656  5.912   133.263 1.00 20.52 ? 367  ILE A N     1 
ATOM   1913 C  CA    . ILE E 3 49 ? 53.305  5.613   133.722 1.00 13.78 ? 367  ILE A CA    1 
ATOM   1914 C  C     . ILE E 3 49 ? 52.954  4.162   133.551 1.00 15.09 ? 367  ILE A C     1 
ATOM   1915 O  O     . ILE E 3 49 ? 52.480  3.532   134.481 1.00 23.58 ? 367  ILE A O     1 
ATOM   1916 C  CB    . ILE E 3 49 ? 52.271  6.440   132.952 1.00 10.00 ? 367  ILE A CB    1 
ATOM   1917 C  CG1   . ILE E 3 49 ? 52.503  7.914   133.238 1.00 10.94 ? 367  ILE A CG1   1 
ATOM   1918 C  CG2   . ILE E 3 49 ? 50.890  6.114   133.428 1.00 7.99  ? 367  ILE A CG2   1 
ATOM   1919 C  CD1   . ILE E 3 49 ? 51.676  8.828   132.421 1.00 15.06 ? 367  ILE A CD1   1 
ATOM   1920 N  N     . ASP E 3 50 ? 53.147  3.637   132.347 1.00 19.25 ? 368  ASP A N     1 
ATOM   1921 C  CA    . ASP E 3 50 ? 52.835  2.240   132.056 1.00 19.39 ? 368  ASP A CA    1 
ATOM   1922 C  C     . ASP E 3 50 ? 53.785  1.290   132.763 1.00 17.94 ? 368  ASP A C     1 
ATOM   1923 O  O     . ASP E 3 50 ? 53.403  0.187   133.141 1.00 22.19 ? 368  ASP A O     1 
ATOM   1924 C  CB    . ASP E 3 50 ? 52.880  1.967   130.560 1.00 24.61 ? 368  ASP A CB    1 
ATOM   1925 C  CG    . ASP E 3 50 ? 51.945  2.857   129.761 1.00 31.88 ? 368  ASP A CG    1 
ATOM   1926 O  OD1   . ASP E 3 50 ? 50.894  3.267   130.292 1.00 36.45 ? 368  ASP A OD1   1 
ATOM   1927 O  OD2   . ASP E 3 50 ? 52.264  3.145   128.580 1.00 40.49 ? 368  ASP A OD2   1 
ATOM   1928 N  N     . TYR E 3 51 ? 55.035  1.697   132.915 1.00 20.75 ? 369  TYR A N     1 
ATOM   1929 C  CA    . TYR E 3 51 ? 56.019  0.871   133.603 1.00 15.08 ? 369  TYR A CA    1 
ATOM   1930 C  C     . TYR E 3 51 ? 55.609  0.759   135.075 1.00 22.29 ? 369  TYR A C     1 
ATOM   1931 O  O     . TYR E 3 51 ? 55.595  -0.337  135.617 1.00 31.39 ? 369  TYR A O     1 
ATOM   1932 C  CB    . TYR E 3 51 ? 57.409  1.490   133.484 1.00 14.35 ? 369  TYR A CB    1 
ATOM   1933 C  CG    . TYR E 3 51 ? 58.544  0.592   133.956 1.00 18.05 ? 369  TYR A CG    1 
ATOM   1934 C  CD1   . TYR E 3 51 ? 58.386  -0.794  134.035 1.00 15.98 ? 369  TYR A CD1   1 
ATOM   1935 C  CD2   . TYR E 3 51 ? 59.748  1.146   134.411 1.00 18.98 ? 369  TYR A CD2   1 
ATOM   1936 C  CE1   . TYR E 3 51 ? 59.393  -1.603  134.566 1.00 20.05 ? 369  TYR A CE1   1 
ATOM   1937 C  CE2   . TYR E 3 51 ? 60.748  0.349   134.946 1.00 16.66 ? 369  TYR A CE2   1 
ATOM   1938 C  CZ    . TYR E 3 51 ? 60.559  -1.014  135.017 1.00 16.40 ? 369  TYR A CZ    1 
ATOM   1939 O  OH    . TYR E 3 51 ? 61.548  -1.788  135.545 1.00 23.87 ? 369  TYR A OH    1 
ATOM   1940 N  N     . ILE E 3 52 ? 55.261  1.876   135.721 1.00 21.56 ? 370  ILE A N     1 
ATOM   1941 C  CA    . ILE E 3 52 ? 54.826  1.842   137.115 1.00 20.67 ? 370  ILE A CA    1 
ATOM   1942 C  C     . ILE E 3 52 ? 53.664  0.871   137.233 1.00 21.82 ? 370  ILE A C     1 
ATOM   1943 O  O     . ILE E 3 52 ? 53.737  -0.074  138.003 1.00 33.58 ? 370  ILE A O     1 
ATOM   1944 C  CB    . ILE E 3 52 ? 54.415  3.240   137.630 1.00 21.38 ? 370  ILE A CB    1 
ATOM   1945 C  CG1   . ILE E 3 52 ? 55.652  4.078   137.878 1.00 18.77 ? 370  ILE A CG1   1 
ATOM   1946 C  CG2   . ILE E 3 52 ? 53.603  3.165   138.896 1.00 17.15 ? 370  ILE A CG2   1 
ATOM   1947 C  CD1   . ILE E 3 52 ? 55.326  5.523   138.020 1.00 20.99 ? 370  ILE A CD1   1 
ATOM   1948 N  N     . ARG E 3 53 ? 52.636  1.028   136.411 1.00 23.82 ? 371  ARG A N     1 
ATOM   1949 C  CA    . ARG E 3 53 ? 51.498  0.124   136.477 1.00 18.51 ? 371  ARG A CA    1 
ATOM   1950 C  C     . ARG E 3 53 ? 51.925  -1.306  136.314 1.00 22.69 ? 371  ARG A C     1 
ATOM   1951 O  O     . ARG E 3 53 ? 51.337  -2.216  136.896 1.00 31.11 ? 371  ARG A O     1 
ATOM   1952 C  CB    . ARG E 3 53 ? 50.509  0.434   135.394 1.00 16.31 ? 371  ARG A CB    1 
ATOM   1953 C  CG    . ARG E 3 53 ? 49.646  1.585   135.689 1.00 23.93 ? 371  ARG A CG    1 
ATOM   1954 C  CD    . ARG E 3 53 ? 48.944  1.315   136.987 1.00 28.18 ? 371  ARG A CD    1 
ATOM   1955 N  NE    . ARG E 3 53 ? 47.829  2.224   137.121 1.00 31.96 ? 371  ARG A NE    1 
ATOM   1956 C  CZ    . ARG E 3 53 ? 47.368  2.662   138.274 1.00 29.67 ? 371  ARG A CZ    1 
ATOM   1957 N  NH1   . ARG E 3 53 ? 47.962  2.270   139.393 1.00 24.62 ? 371  ARG A NH1   1 
ATOM   1958 N  NH2   . ARG E 3 53 ? 46.277  3.435   138.293 1.00 31.07 ? 371  ARG A NH2   1 
ATOM   1959 N  N     . PHE E 3 54 ? 52.898  -1.532  135.456 1.00 22.22 ? 372  PHE A N     1 
ATOM   1960 C  CA    . PHE E 3 54 ? 53.343  -2.886  135.260 1.00 22.62 ? 372  PHE A CA    1 
ATOM   1961 C  C     . PHE E 3 54 ? 54.074  -3.363  136.498 1.00 21.57 ? 372  PHE A C     1 
ATOM   1962 O  O     . PHE E 3 54 ? 53.924  -4.519  136.864 1.00 27.90 ? 372  PHE A O     1 
ATOM   1963 C  CB    . PHE E 3 54 ? 54.255  -3.015  134.044 1.00 21.42 ? 372  PHE A CB    1 
ATOM   1964 C  CG    . PHE E 3 54 ? 55.151  -4.195  134.119 1.00 17.22 ? 372  PHE A CG    1 
ATOM   1965 C  CD1   . PHE E 3 54 ? 54.657  -5.472  133.892 1.00 17.14 ? 372  PHE A CD1   1 
ATOM   1966 C  CD2   . PHE E 3 54 ? 56.466  -4.056  134.546 1.00 23.92 ? 372  PHE A CD2   1 
ATOM   1967 C  CE1   . PHE E 3 54 ? 55.441  -6.573  134.103 1.00 10.91 ? 372  PHE A CE1   1 
ATOM   1968 C  CE2   . PHE E 3 54 ? 57.269  -5.179  134.763 1.00 11.12 ? 372  PHE A CE2   1 
ATOM   1969 C  CZ    . PHE E 3 54 ? 56.750  -6.418  134.541 1.00 12.75 ? 372  PHE A CZ    1 
ATOM   1970 N  N     . LEU E 3 55 ? 54.874  -2.497  137.124 1.00 20.84 ? 373  LEU A N     1 
ATOM   1971 C  CA    . LEU E 3 55 ? 55.647  -2.846  138.322 1.00 16.67 ? 373  LEU A CA    1 
ATOM   1972 C  C     . LEU E 3 55 ? 54.715  -3.160  139.463 1.00 21.83 ? 373  LEU A C     1 
ATOM   1973 O  O     . LEU E 3 55 ? 54.975  -4.051  140.265 1.00 22.32 ? 373  LEU A O     1 
ATOM   1974 C  CB    . LEU E 3 55 ? 56.548  -1.702  138.723 1.00 20.78 ? 373  LEU A CB    1 
ATOM   1975 C  CG    . LEU E 3 55 ? 57.714  -1.384  137.793 1.00 20.84 ? 373  LEU A CG    1 
ATOM   1976 C  CD1   . LEU E 3 55 ? 58.376  -0.110  138.269 1.00 19.13 ? 373  LEU A CD1   1 
ATOM   1977 C  CD2   . LEU E 3 55 ? 58.709  -2.559  137.763 1.00 17.05 ? 373  LEU A CD2   1 
ATOM   1978 N  N     . GLN E 3 56 ? 53.629  -2.407  139.531 1.00 20.62 ? 374  GLN A N     1 
ATOM   1979 C  CA    . GLN E 3 56 ? 52.604  -2.594  140.529 1.00 16.70 ? 374  GLN A CA    1 
ATOM   1980 C  C     . GLN E 3 56 ? 51.922  -3.912  140.319 1.00 19.92 ? 374  GLN A C     1 
ATOM   1981 O  O     . GLN E 3 56 ? 51.716  -4.655  141.255 1.00 30.29 ? 374  GLN A O     1 
ATOM   1982 C  CB    . GLN E 3 56 ? 51.561  -1.493  140.435 1.00 13.41 ? 374  GLN A CB    1 
ATOM   1983 C  CG    . GLN E 3 56 ? 52.128  -0.137  140.772 1.00 19.61 ? 374  GLN A CG    1 
ATOM   1984 C  CD    . GLN E 3 56 ? 51.093  0.945   140.760 1.00 18.77 ? 374  GLN A CD    1 
ATOM   1985 O  OE1   . GLN E 3 56 ? 50.333  1.058   139.814 1.00 26.36 ? 374  GLN A OE1   1 
ATOM   1986 N  NE2   . GLN E 3 56 ? 51.038  1.735   141.830 1.00 20.50 ? 374  GLN A NE2   1 
ATOM   1987 N  N     . HIS E 3 57 ? 51.502  -4.184  139.099 1.00 23.54 ? 375  HIS A N     1 
ATOM   1988 C  CA    . HIS E 3 57 ? 50.818  -5.430  138.814 1.00 23.59 ? 375  HIS A CA    1 
ATOM   1989 C  C     . HIS E 3 57 ? 51.708  -6.653  139.064 1.00 22.77 ? 375  HIS A C     1 
ATOM   1990 O  O     . HIS E 3 57 ? 51.244  -7.707  139.517 1.00 23.96 ? 375  HIS A O     1 
ATOM   1991 C  CB    . HIS E 3 57 ? 50.341  -5.429  137.367 1.00 22.26 ? 375  HIS A CB    1 
ATOM   1992 C  CG    . HIS E 3 57 ? 49.281  -4.419  137.077 1.00 21.38 ? 375  HIS A CG    1 
ATOM   1993 N  ND1   . HIS E 3 57 ? 48.989  -3.992  135.800 1.00 26.80 ? 375  HIS A ND1   1 
ATOM   1994 C  CD2   . HIS E 3 57 ? 48.419  -3.772  137.895 1.00 22.43 ? 375  HIS A CD2   1 
ATOM   1995 C  CE1   . HIS E 3 57 ? 47.990  -3.128  135.839 1.00 23.70 ? 375  HIS A CE1   1 
ATOM   1996 N  NE2   . HIS E 3 57 ? 47.625  -2.983  137.100 1.00 27.63 ? 375  HIS A NE2   1 
ATOM   1997 N  N     . SER E 3 58 ? 52.980  -6.495  138.731 1.00 22.63 ? 376  SER A N     1 
ATOM   1998 C  CA    . SER E 3 58 ? 53.998  -7.528  138.879 1.00 25.20 ? 376  SER A CA    1 
ATOM   1999 C  C     . SER E 3 58 ? 54.213  -7.804  140.365 1.00 25.97 ? 376  SER A C     1 
ATOM   2000 O  O     . SER E 3 58 ? 54.194  -8.945  140.798 1.00 30.24 ? 376  SER A O     1 
ATOM   2001 C  CB    . SER E 3 58 ? 55.299  -7.034  138.231 1.00 25.55 ? 376  SER A CB    1 
ATOM   2002 O  OG    . SER E 3 58 ? 56.350  -7.972  138.288 1.00 30.52 ? 376  SER A OG    1 
ATOM   2003 N  N     . ASN E 3 59 ? 54.386  -6.748  141.146 1.00 21.87 ? 377  ASN A N     1 
ATOM   2004 C  CA    . ASN E 3 59 ? 54.584  -6.885  142.561 1.00 20.50 ? 377  ASN A CA    1 
ATOM   2005 C  C     . ASN E 3 59 ? 53.433  -7.710  143.139 1.00 21.79 ? 377  ASN A C     1 
ATOM   2006 O  O     . ASN E 3 59 ? 53.662  -8.699  143.804 1.00 26.59 ? 377  ASN A O     1 
ATOM   2007 C  CB    . ASN E 3 59 ? 54.663  -5.503  143.184 1.00 25.52 ? 377  ASN A CB    1 
ATOM   2008 C  CG    . ASN E 3 59 ? 55.030  -5.543  144.646 1.00 26.66 ? 377  ASN A CG    1 
ATOM   2009 O  OD1   . ASN E 3 59 ? 54.154  -5.584  145.504 1.00 32.82 ? 377  ASN A OD1   1 
ATOM   2010 N  ND2   . ASN E 3 59 ? 56.313  -5.494  144.943 1.00 22.57 ? 377  ASN A ND2   1 
ATOM   2011 N  N     . GLN E 3 60 ? 52.201  -7.395  142.781 1.00 20.13 ? 378  GLN A N     1 
ATOM   2012 C  CA    . GLN E 3 60 ? 51.077  -8.147  143.281 1.00 20.11 ? 378  GLN A CA    1 
ATOM   2013 C  C     . GLN E 3 60 ? 51.197  -9.599  142.858 1.00 31.60 ? 378  GLN A C     1 
ATOM   2014 O  O     . GLN E 3 60 ? 50.969  -10.508 143.662 1.00 39.67 ? 378  GLN A O     1 
ATOM   2015 C  CB    . GLN E 3 60 ? 49.785  -7.591  142.744 1.00 25.73 ? 378  GLN A CB    1 
ATOM   2016 C  CG    . GLN E 3 60 ? 48.610  -7.885  143.641 1.00 39.65 ? 378  GLN A CG    1 
ATOM   2017 C  CD    . GLN E 3 60 ? 47.360  -8.310  142.885 1.00 49.33 ? 378  GLN A CD    1 
ATOM   2018 O  OE1   . GLN E 3 60 ? 47.429  -9.126  141.951 1.00 62.30 ? 378  GLN A OE1   1 
ATOM   2019 N  NE2   . GLN E 3 60 ? 46.207  -7.779  143.292 1.00 46.83 ? 378  GLN A NE2   1 
ATOM   2020 N  N     . LYS E 3 61 ? 51.544  -9.825  141.592 1.00 35.59 ? 379  LYS A N     1 
ATOM   2021 C  CA    . LYS E 3 61 ? 51.701  -11.173 141.065 1.00 28.28 ? 379  LYS A CA    1 
ATOM   2022 C  C     . LYS E 3 61 ? 52.781  -11.911 141.824 1.00 24.14 ? 379  LYS A C     1 
ATOM   2023 O  O     . LYS E 3 61 ? 52.595  -13.021 142.255 1.00 25.94 ? 379  LYS A O     1 
ATOM   2024 C  CB    . LYS E 3 61 ? 52.073  -11.125 139.589 1.00 31.28 ? 379  LYS A CB    1 
ATOM   2025 C  CG    . LYS E 3 61 ? 50.920  -10.749 138.672 1.00 42.25 ? 379  LYS A CG    1 
ATOM   2026 C  CD    . LYS E 3 61 ? 51.321  -10.865 137.192 1.00 52.83 ? 379  LYS A CD    1 
ATOM   2027 C  CE    . LYS E 3 61 ? 50.103  -11.111 136.281 1.00 61.97 ? 379  LYS A CE    1 
ATOM   2028 N  NZ    . LYS E 3 61 ? 50.438  -11.986 135.088 1.00 62.26 ? 379  LYS A NZ    1 
ATOM   2029 N  N     . LEU E 3 62 ? 53.905  -11.255 142.007 1.00 26.00 ? 380  LEU A N     1 
ATOM   2030 C  CA    . LEU E 3 62 ? 55.053  -11.812 142.697 1.00 25.56 ? 380  LEU A CA    1 
ATOM   2031 C  C     . LEU E 3 62 ? 54.753  -12.165 144.157 1.00 28.00 ? 380  LEU A C     1 
ATOM   2032 O  O     . LEU E 3 62 ? 55.258  -13.175 144.679 1.00 25.95 ? 380  LEU A O     1 
ATOM   2033 C  CB    . LEU E 3 62 ? 56.217  -10.808 142.646 1.00 21.37 ? 380  LEU A CB    1 
ATOM   2034 C  CG    . LEU E 3 62 ? 56.938  -10.664 141.319 1.00 16.80 ? 380  LEU A CG    1 
ATOM   2035 C  CD1   . LEU E 3 62 ? 57.981  -9.581  141.350 1.00 20.29 ? 380  LEU A CD1   1 
ATOM   2036 C  CD2   . LEU E 3 62 ? 57.596  -11.981 141.045 1.00 25.89 ? 380  LEU A CD2   1 
ATOM   2037 N  N     . LYS E 3 63 ? 53.959  -11.331 144.824 1.00 23.61 ? 381  LYS A N     1 
ATOM   2038 C  CA    . LYS E 3 63 ? 53.637  -11.590 146.200 1.00 21.37 ? 381  LYS A CA    1 
ATOM   2039 C  C     . LYS E 3 63 ? 52.729  -12.784 146.278 1.00 26.62 ? 381  LYS A C     1 
ATOM   2040 O  O     . LYS E 3 63 ? 52.885  -13.633 147.158 1.00 32.56 ? 381  LYS A O     1 
ATOM   2041 C  CB    . LYS E 3 63 ? 52.980  -10.399 146.856 1.00 19.32 ? 381  LYS A CB    1 
ATOM   2042 C  CG    . LYS E 3 63 ? 53.896  -9.260  147.167 1.00 17.93 ? 381  LYS A CG    1 
ATOM   2043 C  CD    . LYS E 3 63 ? 53.095  -8.317  148.039 1.00 25.13 ? 381  LYS A CD    1 
ATOM   2044 C  CE    . LYS E 3 63 ? 53.656  -6.907  148.136 1.00 30.06 ? 381  LYS A CE    1 
ATOM   2045 N  NZ    . LYS E 3 63 ? 55.150  -6.887  148.247 1.00 45.48 ? 381  LYS A NZ    1 
ATOM   2046 N  N     . GLN E 3 64 ? 51.760  -12.866 145.381 1.00 28.46 ? 382  GLN A N     1 
ATOM   2047 C  CA    . GLN E 3 64 ? 50.864  -14.008 145.415 1.00 28.99 ? 382  GLN A CA    1 
ATOM   2048 C  C     . GLN E 3 64 ? 51.660  -15.277 145.186 1.00 32.09 ? 382  GLN A C     1 
ATOM   2049 O  O     . GLN E 3 64 ? 51.452  -16.263 145.861 1.00 42.13 ? 382  GLN A O     1 
ATOM   2050 C  CB    . GLN E 3 64 ? 49.788  -13.898 144.356 1.00 36.35 ? 382  GLN A CB    1 
ATOM   2051 C  CG    . GLN E 3 64 ? 48.922  -15.154 144.252 1.00 47.97 ? 382  GLN A CG    1 
ATOM   2052 C  CD    . GLN E 3 64 ? 47.456  -14.858 144.478 1.00 59.12 ? 382  GLN A CD    1 
ATOM   2053 O  OE1   . GLN E 3 64 ? 46.954  -13.796 144.075 1.00 67.27 ? 382  GLN A OE1   1 
ATOM   2054 N  NE2   . GLN E 3 64 ? 46.763  -15.767 145.161 1.00 58.99 ? 382  GLN A NE2   1 
ATOM   2055 N  N     . GLU E 3 65 ? 52.596  -15.233 144.255 1.00 32.49 ? 383  GLU A N     1 
ATOM   2056 C  CA    . GLU E 3 65 ? 53.424  -16.377 143.924 1.00 33.82 ? 383  GLU A CA    1 
ATOM   2057 C  C     . GLU E 3 65 ? 54.268  -16.779 145.111 1.00 34.35 ? 383  GLU A C     1 
ATOM   2058 O  O     . GLU E 3 65 ? 54.452  -17.960 145.395 1.00 35.26 ? 383  GLU A O     1 
ATOM   2059 C  CB    . GLU E 3 65 ? 54.340  -16.009 142.779 1.00 35.71 ? 383  GLU A CB    1 
ATOM   2060 C  CG    . GLU E 3 65 ? 55.228  -17.112 142.301 1.00 48.60 ? 383  GLU A CG    1 
ATOM   2061 C  CD    . GLU E 3 65 ? 56.316  -16.567 141.417 1.00 64.70 ? 383  GLU A CD    1 
ATOM   2062 O  OE1   . GLU E 3 65 ? 56.003  -15.833 140.447 1.00 72.51 ? 383  GLU A OE1   1 
ATOM   2063 O  OE2   . GLU E 3 65 ? 57.490  -16.835 141.713 1.00 63.03 ? 383  GLU A OE2   1 
ATOM   2064 N  N     . ASN E 3 66 ? 54.833  -15.776 145.759 1.00 33.83 ? 384  ASN A N     1 
ATOM   2065 C  CA    . ASN E 3 66 ? 55.667  -15.979 146.929 1.00 32.35 ? 384  ASN A CA    1 
ATOM   2066 C  C     . ASN E 3 66 ? 54.883  -16.727 147.999 1.00 34.05 ? 384  ASN A C     1 
ATOM   2067 O  O     . ASN E 3 66 ? 55.388  -17.668 148.606 1.00 39.02 ? 384  ASN A O     1 
ATOM   2068 C  CB    . ASN E 3 66 ? 56.092  -14.633 147.472 1.00 27.69 ? 384  ASN A CB    1 
ATOM   2069 C  CG    . ASN E 3 66 ? 57.105  -14.748 148.526 1.00 20.27 ? 384  ASN A CG    1 
ATOM   2070 O  OD1   . ASN E 3 66 ? 58.286  -14.882 148.252 1.00 26.62 ? 384  ASN A OD1   1 
ATOM   2071 N  ND2   . ASN E 3 66 ? 56.666  -14.705 149.750 1.00 21.14 ? 384  ASN A ND2   1 
ATOM   2072 N  N     . LEU E 3 67 ? 53.624  -16.351 148.176 1.00 32.29 ? 385  LEU A N     1 
ATOM   2073 C  CA    . LEU E 3 67 ? 52.775  -16.987 149.169 1.00 30.82 ? 385  LEU A CA    1 
ATOM   2074 C  C     . LEU E 3 67 ? 52.491  -18.422 148.771 1.00 30.84 ? 385  LEU A C     1 
ATOM   2075 O  O     . LEU E 3 67 ? 52.632  -19.319 149.578 1.00 38.16 ? 385  LEU A O     1 
ATOM   2076 C  CB    . LEU E 3 67 ? 51.491  -16.199 149.354 1.00 28.39 ? 385  LEU A CB    1 
ATOM   2077 C  CG    . LEU E 3 67 ? 50.570  -16.705 150.448 1.00 30.02 ? 385  LEU A CG    1 
ATOM   2078 C  CD1   . LEU E 3 67 ? 51.294  -16.836 151.782 1.00 30.44 ? 385  LEU A CD1   1 
ATOM   2079 C  CD2   . LEU E 3 67 ? 49.435  -15.742 150.565 1.00 32.24 ? 385  LEU A CD2   1 
ATOM   2080 N  N     . SER E 3 68 ? 52.114  -18.652 147.525 1.00 34.62 ? 386  SER A N     1 
ATOM   2081 C  CA    . SER E 3 68 ? 51.873  -20.009 147.056 1.00 33.62 ? 386  SER A CA    1 
ATOM   2082 C  C     . SER E 3 68 ? 53.117  -20.872 147.180 1.00 29.97 ? 386  SER A C     1 
ATOM   2083 O  O     . SER E 3 68 ? 53.031  -22.033 147.526 1.00 31.74 ? 386  SER A O     1 
ATOM   2084 C  CB    . SER E 3 68 ? 51.414  -20.002 145.610 1.00 32.73 ? 386  SER A CB    1 
ATOM   2085 O  OG    . SER E 3 68 ? 50.105  -19.479 145.569 1.00 51.23 ? 386  SER A OG    1 
ATOM   2086 N  N     . LEU E 3 69 ? 54.268  -20.332 146.848 1.00 27.09 ? 387  LEU A N     1 
ATOM   2087 C  CA    . LEU E 3 69 ? 55.475  -21.104 146.972 1.00 30.40 ? 387  LEU A CA    1 
ATOM   2088 C  C     . LEU E 3 69 ? 55.662  -21.454 148.444 1.00 38.33 ? 387  LEU A C     1 
ATOM   2089 O  O     . LEU E 3 69 ? 55.962  -22.606 148.784 1.00 43.64 ? 387  LEU A O     1 
ATOM   2090 C  CB    . LEU E 3 69 ? 56.659  -20.296 146.468 1.00 32.54 ? 387  LEU A CB    1 
ATOM   2091 C  CG    . LEU E 3 69 ? 56.662  -20.146 144.952 1.00 30.28 ? 387  LEU A CG    1 
ATOM   2092 C  CD1   . LEU E 3 69 ? 57.886  -19.413 144.449 1.00 31.68 ? 387  LEU A CD1   1 
ATOM   2093 C  CD2   . LEU E 3 69 ? 56.655  -21.544 144.391 1.00 39.06 ? 387  LEU A CD2   1 
ATOM   2094 N  N     . ARG E 3 70 ? 55.431  -20.469 149.315 1.00 38.44 ? 388  ARG A N     1 
ATOM   2095 C  CA    . ARG E 3 70 ? 55.569  -20.641 150.758 1.00 33.18 ? 388  ARG A CA    1 
ATOM   2096 C  C     . ARG E 3 70 ? 54.579  -21.645 151.326 1.00 38.81 ? 388  ARG A C     1 
ATOM   2097 O  O     . ARG E 3 70 ? 54.924  -22.416 152.229 1.00 42.84 ? 388  ARG A O     1 
ATOM   2098 C  CB    . ARG E 3 70 ? 55.408  -19.305 151.455 1.00 25.73 ? 388  ARG A CB    1 
ATOM   2099 C  CG    . ARG E 3 70 ? 56.643  -18.439 151.352 1.00 24.15 ? 388  ARG A CG    1 
ATOM   2100 C  CD    . ARG E 3 70 ? 56.397  -17.085 151.977 1.00 19.76 ? 388  ARG A CD    1 
ATOM   2101 N  NE    . ARG E 3 70 ? 57.621  -16.300 151.944 1.00 25.62 ? 388  ARG A NE    1 
ATOM   2102 C  CZ    . ARG E 3 70 ? 58.510  -16.269 152.924 1.00 26.53 ? 388  ARG A CZ    1 
ATOM   2103 N  NH1   . ARG E 3 70 ? 58.310  -16.980 154.017 1.00 37.65 ? 388  ARG A NH1   1 
ATOM   2104 N  NH2   . ARG E 3 70 ? 59.607  -15.543 152.813 1.00 24.87 ? 388  ARG A NH2   1 
ATOM   2105 N  N     . THR E 3 71 ? 53.347  -21.625 150.823 1.00 36.87 ? 389  THR A N     1 
ATOM   2106 C  CA    . THR E 3 71 ? 52.330  -22.556 151.270 1.00 36.67 ? 389  THR A CA    1 
ATOM   2107 C  C     . THR E 3 71 ? 52.603  -23.947 150.712 1.00 38.78 ? 389  THR A C     1 
ATOM   2108 O  O     . THR E 3 71 ? 52.105  -24.939 151.233 1.00 42.62 ? 389  THR A O     1 
ATOM   2109 C  CB    . THR E 3 71 ? 50.961  -22.151 150.813 1.00 33.49 ? 389  THR A CB    1 
ATOM   2110 O  OG1   . THR E 3 71 ? 50.670  -20.829 151.269 1.00 40.47 ? 389  THR A OG1   1 
ATOM   2111 C  CG2   . THR E 3 71 ? 49.965  -23.071 151.422 1.00 47.18 ? 389  THR A CG2   1 
ATOM   2112 N  N     . ALA E 3 72 ? 53.368  -23.997 149.629 1.00 41.46 ? 390  ALA A N     1 
ATOM   2113 C  CA    . ALA E 3 72 ? 53.751  -25.235 148.975 1.00 41.81 ? 390  ALA A CA    1 
ATOM   2114 C  C     . ALA E 3 72 ? 54.782  -25.907 149.852 1.00 42.82 ? 390  ALA A C     1 
ATOM   2115 O  O     . ALA E 3 72 ? 54.595  -27.045 150.270 1.00 48.72 ? 390  ALA A O     1 
ATOM   2116 C  CB    . ALA E 3 72 ? 54.367  -24.943 147.609 1.00 42.02 ? 390  ALA A CB    1 
ATOM   2117 N  N     . VAL E 3 73 ? 55.881  -25.199 150.095 1.00 39.90 ? 391  VAL A N     1 
ATOM   2118 C  CA    . VAL E 3 73 ? 56.974  -25.678 150.931 1.00 37.48 ? 391  VAL A CA    1 
ATOM   2119 C  C     . VAL E 3 73 ? 56.452  -26.212 152.261 1.00 35.26 ? 391  VAL A C     1 
ATOM   2120 O  O     . VAL E 3 73 ? 56.815  -27.291 152.693 1.00 43.01 ? 391  VAL A O     1 
ATOM   2121 C  CB    . VAL E 3 73 ? 57.975  -24.553 151.193 1.00 33.39 ? 391  VAL A CB    1 
ATOM   2122 C  CG1   . VAL E 3 73 ? 59.085  -25.036 152.068 1.00 35.30 ? 391  VAL A CG1   1 
ATOM   2123 C  CG2   . VAL E 3 73 ? 58.540  -24.056 149.890 1.00 29.43 ? 391  VAL A CG2   1 
ATOM   2124 N  N     . HIS E 3 74 ? 55.542  -25.480 152.865 1.00 35.04 ? 392  HIS A N     1 
ATOM   2125 C  CA    . HIS E 3 74 ? 54.954  -25.869 154.126 1.00 40.07 ? 392  HIS A CA    1 
ATOM   2126 C  C     . HIS E 3 74 ? 54.348  -27.254 154.030 1.00 42.54 ? 392  HIS A C     1 
ATOM   2127 O  O     . HIS E 3 74 ? 54.722  -28.148 154.768 1.00 52.89 ? 392  HIS A O     1 
ATOM   2128 C  CB    . HIS E 3 74 ? 53.871  -24.870 154.496 1.00 43.84 ? 392  HIS A CB    1 
ATOM   2129 C  CG    . HIS E 3 74 ? 53.400  -24.967 155.911 1.00 50.46 ? 392  HIS A CG    1 
ATOM   2130 N  ND1   . HIS E 3 74 ? 54.089  -24.392 156.961 1.00 50.11 ? 392  HIS A ND1   1 
ATOM   2131 C  CD2   . HIS E 3 74 ? 52.266  -25.488 156.439 1.00 53.99 ? 392  HIS A CD2   1 
ATOM   2132 C  CE1   . HIS E 3 74 ? 53.393  -24.548 158.073 1.00 54.64 ? 392  HIS A CE1   1 
ATOM   2133 N  NE2   . HIS E 3 74 ? 52.282  -25.210 157.785 1.00 50.59 ? 392  HIS A NE2   1 
ATOM   2134 N  N     . LYS E 3 75 ? 53.390  -27.429 153.133 1.00 49.76 ? 393  LYS A N     1 
ATOM   2135 C  CA    . LYS E 3 75 ? 52.718  -28.720 152.954 1.00 49.32 ? 393  LYS A CA    1 
ATOM   2136 C  C     . LYS E 3 75 ? 53.737  -29.826 152.670 1.00 47.27 ? 393  LYS A C     1 
ATOM   2137 O  O     . LYS E 3 75 ? 53.623  -30.960 153.176 1.00 42.53 ? 393  LYS A O     1 
ATOM   2138 C  CB    . LYS E 3 75 ? 51.684  -28.625 151.816 1.00 50.64 ? 393  LYS A CB    1 
ATOM   2139 N  N     . SER E 3 76 ? 54.792  -29.437 151.962 1.00 43.39 ? 394  SER A N     1 
ATOM   2140 C  CA    . SER E 3 76 ? 55.875  -30.327 151.590 1.00 44.34 ? 394  SER A CA    1 
ATOM   2141 C  C     . SER E 3 76 ? 56.571  -30.888 152.817 1.00 51.88 ? 394  SER A C     1 
ATOM   2142 O  O     . SER E 3 76 ? 57.658  -31.457 152.692 1.00 63.96 ? 394  SER A O     1 
ATOM   2143 C  CB    . SER E 3 76 ? 56.879  -29.581 150.744 1.00 41.00 ? 394  SER A CB    1 
ATOM   2144 N  N     . LYS E 3 77 ? 55.988  -30.657 153.998 1.00 57.09 ? 395  LYS A N     1 
ATOM   2145 C  CA    . LYS E 3 77 ? 56.515  -31.116 155.282 1.00 50.63 ? 395  LYS A CA    1 
ATOM   2146 C  C     . LYS E 3 77 ? 55.301  -31.392 156.172 1.00 52.88 ? 395  LYS A C     1 
ATOM   2147 O  O     . LYS E 3 77 ? 55.115  -32.494 156.689 1.00 50.20 ? 395  LYS A O     1 
ATOM   2148 C  CB    . LYS E 3 77 ? 57.368  -30.009 155.902 1.00 44.40 ? 395  LYS A CB    1 
ATOM   2149 C  CG    . LYS E 3 77 ? 58.404  -29.437 154.950 1.00 48.13 ? 395  LYS A CG    1 
ATOM   2150 C  CD    . LYS E 3 77 ? 59.230  -28.328 155.567 1.00 48.70 ? 395  LYS A CD    1 
ATOM   2151 C  CE    . LYS E 3 77 ? 58.363  -27.281 156.244 1.00 45.80 ? 395  LYS A CE    1 
ATOM   2152 N  NZ    . LYS E 3 77 ? 59.174  -26.062 156.555 1.00 49.01 ? 395  LYS A NZ    1 
ATOM   2153 N  N     . SER E 3 78 ? 54.435  -30.392 156.268 1.00 55.56 ? 396  SER A N     1 
ATOM   2154 C  CA    . SER E 3 78 ? 53.221  -30.447 157.074 1.00 59.30 ? 396  SER A CA    1 
ATOM   2155 C  C     . SER E 3 78 ? 52.234  -31.614 156.783 1.00 61.52 ? 396  SER A C     1 
ATOM   2156 O  O     . SER E 3 78 ? 51.067  -31.604 157.230 1.00 61.81 ? 396  SER A O     1 
ATOM   2157 C  CB    . SER E 3 78 ? 52.506  -29.076 157.013 1.00 47.53 ? 396  SER A CB    1 
ATOM   2158 N  N     . LEU E 3 79 ? 52.699  -32.624 156.056 1.00 60.08 ? 397  LEU A N     1 
ATOM   2159 C  CA    . LEU E 3 79 ? 51.862  -33.773 155.743 1.00 60.82 ? 397  LEU A CA    1 
ATOM   2160 C  C     . LEU E 3 79 ? 51.843  -34.720 156.948 1.00 62.88 ? 397  LEU A C     1 
ATOM   2161 O  O     . LEU E 3 79 ? 52.843  -35.397 157.226 1.00 62.77 ? 397  LEU A O     1 
ATOM   2162 C  CB    . LEU E 3 79 ? 52.397  -34.488 154.496 1.00 57.31 ? 397  LEU A CB    1 
ATOM   2163 N  N     . LYS E 3 80 ? 50.718  -34.729 157.672 1.00 60.76 ? 398  LYS A N     1 
ATOM   2164 C  CA    . LYS E 3 80 ? 50.545  -35.582 158.859 1.00 59.12 ? 398  LYS A CA    1 
ATOM   2165 C  C     . LYS E 3 80 ? 49.982  -36.967 158.533 1.00 54.23 ? 398  LYS A C     1 
ATOM   2166 O  O     . LYS E 3 80 ? 50.574  -37.632 157.660 1.00 55.37 ? 398  LYS A O     1 
ATOM   2167 C  CB    . LYS E 3 80 ? 49.661  -34.875 159.906 1.00 47.07 ? 398  LYS A CB    1 
ATOM   2168 N  N     . SER F 3 2  ? 51.904  37.703  109.060 1.00 56.81 ? 320  SER B N     1 
ATOM   2169 C  CA    . SER F 3 2  ? 52.185  36.247  108.880 1.00 58.13 ? 320  SER B CA    1 
ATOM   2170 C  C     . SER F 3 2  ? 53.399  35.741  109.660 1.00 61.43 ? 320  SER B C     1 
ATOM   2171 O  O     . SER F 3 2  ? 53.494  34.545  109.933 1.00 66.88 ? 320  SER B O     1 
ATOM   2172 C  CB    . SER F 3 2  ? 52.251  35.841  107.400 1.00 47.34 ? 320  SER B CB    1 
ATOM   2173 O  OG    . SER F 3 2  ? 50.978  35.394  106.940 1.00 47.37 ? 320  SER B OG    1 
ATOM   2174 N  N     . ARG F 3 3  ? 54.353  36.611  109.989 1.00 60.26 ? 321  ARG B N     1 
ATOM   2175 C  CA    . ARG F 3 3  ? 55.464  36.142  110.820 1.00 58.49 ? 321  ARG B CA    1 
ATOM   2176 C  C     . ARG F 3 3  ? 54.614  35.864  112.051 1.00 59.09 ? 321  ARG B C     1 
ATOM   2177 O  O     . ARG F 3 3  ? 54.484  34.723  112.494 1.00 64.95 ? 321  ARG B O     1 
ATOM   2178 C  CB    . ARG F 3 3  ? 56.470  37.262  111.110 1.00 49.30 ? 321  ARG B CB    1 
ATOM   2179 N  N     . GLY F 3 4  ? 53.836  36.885  112.407 1.00 58.65 ? 322  GLY B N     1 
ATOM   2180 C  CA    . GLY F 3 4  ? 52.938  36.800  113.540 1.00 59.33 ? 322  GLY B CA    1 
ATOM   2181 C  C     . GLY F 3 4  ? 51.891  35.710  113.391 1.00 62.96 ? 322  GLY B C     1 
ATOM   2182 O  O     . GLY F 3 4  ? 51.709  34.934  114.330 1.00 67.37 ? 322  GLY B O     1 
ATOM   2183 N  N     . GLU F 3 5  ? 51.208  35.635  112.243 1.00 57.00 ? 323  GLU B N     1 
ATOM   2184 C  CA    . GLU F 3 5  ? 50.181  34.606  112.045 1.00 51.72 ? 323  GLU B CA    1 
ATOM   2185 C  C     . GLU F 3 5  ? 50.825  33.236  112.155 1.00 49.51 ? 323  GLU B C     1 
ATOM   2186 O  O     . GLU F 3 5  ? 50.248  32.301  112.721 1.00 51.53 ? 323  GLU B O     1 
ATOM   2187 C  CB    . GLU F 3 5  ? 49.498  34.736  110.684 1.00 52.55 ? 323  GLU B CB    1 
ATOM   2188 C  CG    . GLU F 3 5  ? 48.696  36.013  110.463 1.00 53.08 ? 323  GLU B CG    1 
ATOM   2189 C  CD    . GLU F 3 5  ? 48.671  36.433  108.982 1.00 66.04 ? 323  GLU B CD    1 
ATOM   2190 O  OE1   . GLU F 3 5  ? 48.067  35.702  108.150 1.00 69.34 ? 323  GLU B OE1   1 
ATOM   2191 O  OE2   . GLU F 3 5  ? 49.275  37.490  108.646 1.00 62.72 ? 323  GLU B OE2   1 
ATOM   2192 N  N     . LYS F 3 6  ? 52.047  33.133  111.656 1.00 48.11 ? 324  LYS B N     1 
ATOM   2193 C  CA    . LYS F 3 6  ? 52.752  31.872  111.726 1.00 52.35 ? 324  LYS B CA    1 
ATOM   2194 C  C     . LYS F 3 6  ? 53.025  31.585  113.205 1.00 53.68 ? 324  LYS B C     1 
ATOM   2195 O  O     . LYS F 3 6  ? 52.823  30.463  113.668 1.00 56.65 ? 324  LYS B O     1 
ATOM   2196 C  CB    . LYS F 3 6  ? 54.033  31.930  110.927 1.00 50.39 ? 324  LYS B CB    1 
ATOM   2197 N  N     . ARG F 3 7  ? 53.402  32.621  113.954 1.00 50.45 ? 325  ARG B N     1 
ATOM   2198 C  CA    . ARG F 3 7  ? 53.670  32.488  115.383 1.00 45.65 ? 325  ARG B CA    1 
ATOM   2199 C  C     . ARG F 3 7  ? 52.446  31.982  116.110 1.00 42.41 ? 325  ARG B C     1 
ATOM   2200 O  O     . ARG F 3 7  ? 52.518  30.985  116.807 1.00 43.48 ? 325  ARG B O     1 
ATOM   2201 C  CB    . ARG F 3 7  ? 54.087  33.827  116.002 1.00 47.10 ? 325  ARG B CB    1 
ATOM   2202 C  CG    . ARG F 3 7  ? 55.576  34.093  115.960 1.00 51.75 ? 325  ARG B CG    1 
ATOM   2203 C  CD    . ARG F 3 7  ? 56.347  33.470  117.145 1.00 57.77 ? 325  ARG B CD    1 
ATOM   2204 N  NE    . ARG F 3 7  ? 56.402  32.003  117.182 1.00 57.67 ? 325  ARG B NE    1 
ATOM   2205 C  CZ    . ARG F 3 7  ? 56.112  31.272  118.259 1.00 55.64 ? 325  ARG B CZ    1 
ATOM   2206 N  NH1   . ARG F 3 7  ? 55.730  31.848  119.400 1.00 51.11 ? 325  ARG B NH1   1 
ATOM   2207 N  NH2   . ARG F 3 7  ? 56.252  29.960  118.215 1.00 58.13 ? 325  ARG B NH2   1 
ATOM   2208 N  N     . THR F 3 8  ? 51.318  32.653  115.918 1.00 34.83 ? 326  THR B N     1 
ATOM   2209 C  CA    . THR F 3 8  ? 50.072  32.282  116.570 1.00 34.12 ? 326  THR B CA    1 
ATOM   2210 C  C     . THR F 3 8  ? 49.727  30.838  116.319 1.00 37.26 ? 326  THR B C     1 
ATOM   2211 O  O     . THR F 3 8  ? 49.361  30.078  117.240 1.00 36.00 ? 326  THR B O     1 
ATOM   2212 C  CB    . THR F 3 8  ? 48.944  33.121  116.046 1.00 31.84 ? 326  THR B CB    1 
ATOM   2213 O  OG1   . THR F 3 8  ? 49.299  34.495  116.207 1.00 42.00 ? 326  THR B OG1   1 
ATOM   2214 C  CG2   . THR F 3 8  ? 47.651  32.834  116.795 1.00 32.54 ? 326  THR B CG2   1 
ATOM   2215 N  N     . ALA F 3 9  ? 49.856  30.457  115.058 1.00 36.81 ? 327  ALA B N     1 
ATOM   2216 C  CA    . ALA F 3 9  ? 49.554  29.104  114.683 1.00 36.61 ? 327  ALA B CA    1 
ATOM   2217 C  C     . ALA F 3 9  ? 50.523  28.159  115.415 1.00 33.70 ? 327  ALA B C     1 
ATOM   2218 O  O     . ALA F 3 9  ? 50.098  27.212  116.077 1.00 39.71 ? 327  ALA B O     1 
ATOM   2219 C  CB    . ALA F 3 9  ? 49.652  28.952  113.166 1.00 34.08 ? 327  ALA B CB    1 
ATOM   2220 N  N     . HIS F 3 10 ? 51.817  28.443  115.366 1.00 27.53 ? 328  HIS B N     1 
ATOM   2221 C  CA    . HIS F 3 10 ? 52.737  27.558  116.030 1.00 29.96 ? 328  HIS B CA    1 
ATOM   2222 C  C     . HIS F 3 10 ? 52.522  27.542  117.544 1.00 34.23 ? 328  HIS B C     1 
ATOM   2223 O  O     . HIS F 3 10 ? 52.695  26.508  118.192 1.00 35.81 ? 328  HIS B O     1 
ATOM   2224 C  CB    . HIS F 3 10 ? 54.182  27.867  115.693 1.00 25.93 ? 328  HIS B CB    1 
ATOM   2225 C  CG    . HIS F 3 10 ? 55.088  26.687  115.894 1.00 26.34 ? 328  HIS B CG    1 
ATOM   2226 N  ND1   . HIS F 3 10 ? 55.875  26.533  117.012 1.00 29.31 ? 328  HIS B ND1   1 
ATOM   2227 C  CD2   . HIS F 3 10 ? 55.326  25.606  115.119 1.00 25.21 ? 328  HIS B CD2   1 
ATOM   2228 C  CE1   . HIS F 3 10 ? 56.569  25.414  116.912 1.00 24.85 ? 328  HIS B CE1   1 
ATOM   2229 N  NE2   . HIS F 3 10 ? 56.254  24.835  115.767 1.00 25.30 ? 328  HIS B NE2   1 
ATOM   2230 N  N     . ASN F 3 11 ? 52.088  28.673  118.090 1.00 33.77 ? 329  ASN B N     1 
ATOM   2231 C  CA    . ASN F 3 11 ? 51.823  28.782  119.506 1.00 26.85 ? 329  ASN B CA    1 
ATOM   2232 C  C     . ASN F 3 11 ? 50.797  27.720  119.842 1.00 28.63 ? 329  ASN B C     1 
ATOM   2233 O  O     . ASN F 3 11 ? 50.930  27.058  120.858 1.00 38.53 ? 329  ASN B O     1 
ATOM   2234 C  CB    . ASN F 3 11 ? 51.325  30.187  119.888 1.00 21.53 ? 329  ASN B CB    1 
ATOM   2235 C  CG    . ASN F 3 11 ? 52.474  31.189  120.123 1.00 23.28 ? 329  ASN B CG    1 
ATOM   2236 O  OD1   . ASN F 3 11 ? 53.651  30.823  120.286 1.00 23.35 ? 329  ASN B OD1   1 
ATOM   2237 N  ND2   . ASN F 3 11 ? 52.122  32.459  120.155 1.00 22.43 ? 329  ASN B ND2   1 
ATOM   2238 N  N     . ALA F 3 12 ? 49.801  27.514  118.984 1.00 30.29 ? 330  ALA B N     1 
ATOM   2239 C  CA    . ALA F 3 12 ? 48.800  26.465  119.235 1.00 25.89 ? 330  ALA B CA    1 
ATOM   2240 C  C     . ALA F 3 12 ? 49.462  25.086  119.203 1.00 25.81 ? 330  ALA B C     1 
ATOM   2241 O  O     . ALA F 3 12 ? 49.114  24.178  119.955 1.00 24.36 ? 330  ALA B O     1 
ATOM   2242 C  CB    . ALA F 3 12 ? 47.710  26.522  118.219 1.00 25.04 ? 330  ALA B CB    1 
ATOM   2243 N  N     . ILE F 3 13 ? 50.445  24.951  118.340 1.00 29.76 ? 331  ILE B N     1 
ATOM   2244 C  CA    . ILE F 3 13 ? 51.150  23.703  118.222 1.00 30.83 ? 331  ILE B CA    1 
ATOM   2245 C  C     . ILE F 3 13 ? 51.938  23.462  119.494 1.00 32.63 ? 331  ILE B C     1 
ATOM   2246 O  O     . ILE F 3 13 ? 51.889  22.361  120.066 1.00 42.98 ? 331  ILE B O     1 
ATOM   2247 C  CB    . ILE F 3 13 ? 52.042  23.701  116.937 1.00 35.43 ? 331  ILE B CB    1 
ATOM   2248 C  CG1   . ILE F 3 13 ? 51.134  23.501  115.701 1.00 31.84 ? 331  ILE B CG1   1 
ATOM   2249 C  CG2   . ILE F 3 13 ? 53.160  22.603  117.009 1.00 29.65 ? 331  ILE B CG2   1 
ATOM   2250 C  CD1   . ILE F 3 13 ? 51.685  24.040  114.403 1.00 34.57 ? 331  ILE B CD1   1 
ATOM   2251 N  N     . GLU F 3 14 ? 52.597  24.507  119.987 1.00 36.07 ? 332  GLU B N     1 
ATOM   2252 C  CA    . GLU F 3 14 ? 53.397  24.417  121.205 1.00 30.11 ? 332  GLU B CA    1 
ATOM   2253 C  C     . GLU F 3 14 ? 52.567  24.122  122.444 1.00 25.73 ? 332  GLU B C     1 
ATOM   2254 O  O     . GLU F 3 14 ? 53.047  23.465  123.340 1.00 32.11 ? 332  GLU B O     1 
ATOM   2255 C  CB    . GLU F 3 14 ? 54.183  25.686  121.407 1.00 37.82 ? 332  GLU B CB    1 
ATOM   2256 C  CG    . GLU F 3 14 ? 55.210  25.925  120.333 1.00 45.12 ? 332  GLU B CG    1 
ATOM   2257 C  CD    . GLU F 3 14 ? 55.813  27.326  120.403 1.00 56.54 ? 332  GLU B CD    1 
ATOM   2258 O  OE1   . GLU F 3 14 ? 55.536  28.072  121.386 1.00 49.26 ? 332  GLU B OE1   1 
ATOM   2259 O  OE2   . GLU F 3 14 ? 56.573  27.673  119.465 1.00 54.79 ? 332  GLU B OE2   1 
ATOM   2260 N  N     . LYS F 3 15 ? 51.329  24.603  122.501 1.00 25.03 ? 333  LYS B N     1 
ATOM   2261 C  CA    . LYS F 3 15 ? 50.468  24.322  123.628 1.00 24.23 ? 333  LYS B CA    1 
ATOM   2262 C  C     . LYS F 3 15 ? 50.104  22.845  123.630 1.00 29.62 ? 333  LYS B C     1 
ATOM   2263 O  O     . LYS F 3 15 ? 50.100  22.190  124.674 1.00 30.57 ? 333  LYS B O     1 
ATOM   2264 C  CB    . LYS F 3 15 ? 49.204  25.146  123.579 1.00 22.16 ? 333  LYS B CB    1 
ATOM   2265 C  CG    . LYS F 3 15 ? 48.431  25.026  124.869 1.00 28.77 ? 333  LYS B CG    1 
ATOM   2266 C  CD    . LYS F 3 15 ? 47.314  26.025  124.933 1.00 32.87 ? 333  LYS B CD    1 
ATOM   2267 C  CE    . LYS F 3 15 ? 46.555  25.887  126.240 1.00 43.78 ? 333  LYS B CE    1 
ATOM   2268 N  NZ    . LYS F 3 15 ? 45.369  26.826  126.294 1.00 57.73 ? 333  LYS B NZ    1 
ATOM   2269 N  N     . ARG F 3 16 ? 49.796  22.327  122.453 1.00 29.97 ? 334  ARG B N     1 
ATOM   2270 C  CA    . ARG F 3 16 ? 49.466  20.927  122.273 1.00 27.03 ? 334  ARG B CA    1 
ATOM   2271 C  C     . ARG F 3 16 ? 50.661  20.125  122.788 1.00 25.29 ? 334  ARG B C     1 
ATOM   2272 O  O     . ARG F 3 16 ? 50.521  19.182  123.566 1.00 28.44 ? 334  ARG B O     1 
ATOM   2273 C  CB    . ARG F 3 16 ? 49.279  20.697  120.781 1.00 39.16 ? 334  ARG B CB    1 
ATOM   2274 C  CG    . ARG F 3 16 ? 48.689  19.376  120.339 1.00 49.51 ? 334  ARG B CG    1 
ATOM   2275 C  CD    . ARG F 3 16 ? 48.671  19.338  118.810 1.00 53.40 ? 334  ARG B CD    1 
ATOM   2276 N  NE    . ARG F 3 16 ? 47.926  20.462  118.248 1.00 56.23 ? 334  ARG B NE    1 
ATOM   2277 C  CZ    . ARG F 3 16 ? 48.276  21.134  117.154 1.00 57.98 ? 334  ARG B CZ    1 
ATOM   2278 N  NH1   . ARG F 3 16 ? 49.373  20.806  116.487 1.00 59.47 ? 334  ARG B NH1   1 
ATOM   2279 N  NH2   . ARG F 3 16 ? 47.508  22.122  116.708 1.00 51.36 ? 334  ARG B NH2   1 
ATOM   2280 N  N     . TYR F 3 17 ? 51.853  20.562  122.426 1.00 22.18 ? 335  TYR B N     1 
ATOM   2281 C  CA    . TYR F 3 17 ? 53.089  19.894  122.850 1.00 20.12 ? 335  TYR B CA    1 
ATOM   2282 C  C     . TYR F 3 17 ? 53.300  19.917  124.363 1.00 26.48 ? 335  TYR B C     1 
ATOM   2283 O  O     . TYR F 3 17 ? 53.645  18.907  124.972 1.00 23.95 ? 335  TYR B O     1 
ATOM   2284 C  CB    . TYR F 3 17 ? 54.287  20.556  122.160 1.00 15.43 ? 335  TYR B CB    1 
ATOM   2285 C  CG    . TYR F 3 17 ? 55.612  20.257  122.799 1.00 16.06 ? 335  TYR B CG    1 
ATOM   2286 C  CD1   . TYR F 3 17 ? 56.194  19.002  122.683 1.00 12.98 ? 335  TYR B CD1   1 
ATOM   2287 C  CD2   . TYR F 3 17 ? 56.292  21.233  123.511 1.00 14.23 ? 335  TYR B CD2   1 
ATOM   2288 C  CE1   . TYR F 3 17 ? 57.415  18.730  123.265 1.00 15.96 ? 335  TYR B CE1   1 
ATOM   2289 C  CE2   . TYR F 3 17 ? 57.514  20.971  124.083 1.00 9.65  ? 335  TYR B CE2   1 
ATOM   2290 C  CZ    . TYR F 3 17 ? 58.071  19.727  123.952 1.00 11.59 ? 335  TYR B CZ    1 
ATOM   2291 O  OH    . TYR F 3 17 ? 59.317  19.491  124.465 1.00 21.90 ? 335  TYR B OH    1 
ATOM   2292 N  N     . ARG F 3 18 ? 53.186  21.106  124.945 1.00 28.22 ? 336  ARG B N     1 
ATOM   2293 C  CA    . ARG F 3 18 ? 53.332  21.296  126.377 1.00 22.04 ? 336  ARG B CA    1 
ATOM   2294 C  C     . ARG F 3 18 ? 52.354  20.382  127.078 1.00 21.37 ? 336  ARG B C     1 
ATOM   2295 O  O     . ARG F 3 18 ? 52.710  19.706  128.032 1.00 26.73 ? 336  ARG B O     1 
ATOM   2296 C  CB    . ARG F 3 18 ? 53.055  22.759  126.719 1.00 21.75 ? 336  ARG B CB    1 
ATOM   2297 C  CG    . ARG F 3 18 ? 54.123  23.702  126.176 1.00 23.85 ? 336  ARG B CG    1 
ATOM   2298 C  CD    . ARG F 3 18 ? 54.126  24.999  126.899 1.00 22.35 ? 336  ARG B CD    1 
ATOM   2299 N  NE    . ARG F 3 18 ? 52.865  25.705  126.717 1.00 28.78 ? 336  ARG B NE    1 
ATOM   2300 C  CZ    . ARG F 3 18 ? 52.622  26.529  125.704 1.00 27.37 ? 336  ARG B CZ    1 
ATOM   2301 N  NH1   . ARG F 3 18 ? 53.554  26.727  124.778 1.00 26.09 ? 336  ARG B NH1   1 
ATOM   2302 N  NH2   . ARG F 3 18 ? 51.475  27.194  125.645 1.00 24.39 ? 336  ARG B NH2   1 
ATOM   2303 N  N     . SER F 3 19 ? 51.136  20.314  126.550 1.00 22.51 ? 337  SER B N     1 
ATOM   2304 C  CA    . SER F 3 19 ? 50.120  19.460  127.105 1.00 16.75 ? 337  SER B CA    1 
ATOM   2305 C  C     . SER F 3 19 ? 50.495  17.998  126.984 1.00 23.16 ? 337  SER B C     1 
ATOM   2306 O  O     . SER F 3 19 ? 50.161  17.207  127.846 1.00 28.47 ? 337  SER B O     1 
ATOM   2307 C  CB    . SER F 3 19 ? 48.785  19.715  126.439 1.00 21.08 ? 337  SER B CB    1 
ATOM   2308 O  OG    . SER F 3 19 ? 48.318  21.030  126.748 1.00 31.20 ? 337  SER B OG    1 
ATOM   2309 N  N     . SER F 3 20 ? 51.235  17.630  125.952 1.00 25.49 ? 338  SER B N     1 
ATOM   2310 C  CA    . SER F 3 20 ? 51.623  16.236  125.782 1.00 24.90 ? 338  SER B CA    1 
ATOM   2311 C  C     . SER F 3 20 ? 52.522  15.759  126.902 1.00 24.43 ? 338  SER B C     1 
ATOM   2312 O  O     . SER F 3 20 ? 52.658  14.560  127.126 1.00 26.28 ? 338  SER B O     1 
ATOM   2313 C  CB    . SER F 3 20 ? 52.347  16.041  124.449 1.00 26.00 ? 338  SER B CB    1 
ATOM   2314 O  OG    . SER F 3 20 ? 53.682  16.516  124.499 1.00 26.69 ? 338  SER B OG    1 
ATOM   2315 N  N     . ILE F 3 21 ? 53.233  16.701  127.512 1.00 28.82 ? 339  ILE B N     1 
ATOM   2316 C  CA    . ILE F 3 21 ? 54.142  16.414  128.638 1.00 28.36 ? 339  ILE B CA    1 
ATOM   2317 C  C     . ILE F 3 21 ? 53.361  16.601  129.955 1.00 25.91 ? 339  ILE B C     1 
ATOM   2318 O  O     . ILE F 3 21 ? 53.247  15.685  130.772 1.00 29.75 ? 339  ILE B O     1 
ATOM   2319 C  CB    . ILE F 3 21 ? 55.384  17.357  128.615 1.00 24.48 ? 339  ILE B CB    1 
ATOM   2320 C  CG1   . ILE F 3 21 ? 56.261  17.057  127.392 1.00 18.93 ? 339  ILE B CG1   1 
ATOM   2321 C  CG2   . ILE F 3 21 ? 56.218  17.176  129.860 1.00 28.70 ? 339  ILE B CG2   1 
ATOM   2322 C  CD1   . ILE F 3 21 ? 57.327  18.057  127.155 1.00 12.58 ? 339  ILE B CD1   1 
ATOM   2323 N  N     . ASN F 3 22 ? 52.711  17.747  130.085 1.00 22.10 ? 340  ASN B N     1 
ATOM   2324 C  CA    . ASN F 3 22 ? 51.950  18.038  131.264 1.00 18.32 ? 340  ASN B CA    1 
ATOM   2325 C  C     . ASN F 3 22 ? 50.866  17.055  131.604 1.00 20.27 ? 340  ASN B C     1 
ATOM   2326 O  O     . ASN F 3 22 ? 50.698  16.762  132.759 1.00 24.98 ? 340  ASN B O     1 
ATOM   2327 C  CB    . ASN F 3 22 ? 51.355  19.423  131.171 1.00 19.95 ? 340  ASN B CB    1 
ATOM   2328 C  CG    . ASN F 3 22 ? 52.400  20.482  131.234 1.00 21.84 ? 340  ASN B CG    1 
ATOM   2329 O  OD1   . ASN F 3 22 ? 53.527  20.222  131.667 1.00 27.07 ? 340  ASN B OD1   1 
ATOM   2330 N  ND2   . ASN F 3 22 ? 52.055  21.686  130.799 1.00 22.34 ? 340  ASN B ND2   1 
ATOM   2331 N  N     . ASP F 3 23 ? 50.120  16.544  130.631 1.00 23.93 ? 341  ASP B N     1 
ATOM   2332 C  CA    . ASP F 3 23 ? 49.046  15.600  130.937 1.00 22.76 ? 341  ASP B CA    1 
ATOM   2333 C  C     . ASP F 3 23 ? 49.644  14.304  131.447 1.00 27.12 ? 341  ASP B C     1 
ATOM   2334 O  O     . ASP F 3 23 ? 49.016  13.588  132.219 1.00 29.01 ? 341  ASP B O     1 
ATOM   2335 C  CB    . ASP F 3 23 ? 48.165  15.310  129.721 1.00 29.35 ? 341  ASP B CB    1 
ATOM   2336 C  CG    . ASP F 3 23 ? 47.294  16.515  129.283 1.00 38.46 ? 341  ASP B CG    1 
ATOM   2337 O  OD1   . ASP F 3 23 ? 47.113  17.491  130.058 1.00 37.72 ? 341  ASP B OD1   1 
ATOM   2338 O  OD2   . ASP F 3 23 ? 46.782  16.474  128.127 1.00 41.92 ? 341  ASP B OD2   1 
ATOM   2339 N  N     . LYS F 3 24 ? 50.882  14.016  131.076 1.00 24.55 ? 342  LYS B N     1 
ATOM   2340 C  CA    . LYS F 3 24 ? 51.480  12.782  131.539 1.00 24.62 ? 342  LYS B CA    1 
ATOM   2341 C  C     . LYS F 3 24 ? 51.925  12.948  132.974 1.00 26.05 ? 342  LYS B C     1 
ATOM   2342 O  O     . LYS F 3 24 ? 51.865  12.021  133.768 1.00 32.93 ? 342  LYS B O     1 
ATOM   2343 C  CB    . LYS F 3 24 ? 52.682  12.424  130.702 1.00 27.11 ? 342  LYS B CB    1 
ATOM   2344 C  CG    . LYS F 3 24 ? 52.457  12.425  129.219 1.00 29.66 ? 342  LYS B CG    1 
ATOM   2345 C  CD    . LYS F 3 24 ? 51.721  11.229  128.719 1.00 31.50 ? 342  LYS B CD    1 
ATOM   2346 C  CE    . LYS F 3 24 ? 51.983  11.148  127.230 1.00 32.92 ? 342  LYS B CE    1 
ATOM   2347 N  NZ    . LYS F 3 24 ? 51.384  12.303  126.474 1.00 36.80 ? 342  LYS B NZ    1 
ATOM   2348 N  N     . ILE F 3 25 ? 52.446  14.121  133.292 1.00 28.91 ? 343  ILE B N     1 
ATOM   2349 C  CA    . ILE F 3 25 ? 52.897  14.413  134.652 1.00 24.64 ? 343  ILE B CA    1 
ATOM   2350 C  C     . ILE F 3 25 ? 51.690  14.310  135.587 1.00 22.58 ? 343  ILE B C     1 
ATOM   2351 O  O     . ILE F 3 25 ? 51.788  13.768  136.678 1.00 28.41 ? 343  ILE B O     1 
ATOM   2352 C  CB    . ILE F 3 25 ? 53.581  15.814  134.722 1.00 20.84 ? 343  ILE B CB    1 
ATOM   2353 C  CG1   . ILE F 3 25 ? 54.850  15.789  133.869 1.00 19.00 ? 343  ILE B CG1   1 
ATOM   2354 C  CG2   . ILE F 3 25 ? 53.937  16.163  136.122 1.00 15.17 ? 343  ILE B CG2   1 
ATOM   2355 C  CD1   . ILE F 3 25 ? 55.675  17.074  133.933 1.00 23.67 ? 343  ILE B CD1   1 
ATOM   2356 N  N     . ILE F 3 26 ? 50.540  14.782  135.124 1.00 22.65 ? 344  ILE B N     1 
ATOM   2357 C  CA    . ILE F 3 26 ? 49.318  14.718  135.900 1.00 20.83 ? 344  ILE B CA    1 
ATOM   2358 C  C     . ILE F 3 26 ? 48.960  13.252  136.132 1.00 26.25 ? 344  ILE B C     1 
ATOM   2359 O  O     . ILE F 3 26 ? 48.563  12.891  137.238 1.00 33.27 ? 344  ILE B O     1 
ATOM   2360 C  CB    . ILE F 3 26 ? 48.188  15.502  135.198 1.00 19.72 ? 344  ILE B CB    1 
ATOM   2361 C  CG1   . ILE F 3 26 ? 48.454  16.988  135.353 1.00 12.58 ? 344  ILE B CG1   1 
ATOM   2362 C  CG2   . ILE F 3 26 ? 46.811  15.160  135.767 1.00 20.37 ? 344  ILE B CG2   1 
ATOM   2363 C  CD1   . ILE F 3 26 ? 47.715  17.806  134.379 1.00 19.10 ? 344  ILE B CD1   1 
ATOM   2364 N  N     . GLU F 3 27 ? 49.140  12.398  135.122 1.00 27.32 ? 345  GLU B N     1 
ATOM   2365 C  CA    . GLU F 3 27 ? 48.861  10.970  135.283 1.00 22.80 ? 345  GLU B CA    1 
ATOM   2366 C  C     . GLU F 3 27 ? 49.846  10.351  136.246 1.00 21.69 ? 345  GLU B C     1 
ATOM   2367 O  O     . GLU F 3 27 ? 49.491  9.492   137.048 1.00 24.16 ? 345  GLU B O     1 
ATOM   2368 C  CB    . GLU F 3 27 ? 49.020  10.233  133.983 1.00 27.05 ? 345  GLU B CB    1 
ATOM   2369 C  CG    . GLU F 3 27 ? 47.912  10.394  133.028 1.00 30.45 ? 345  GLU B CG    1 
ATOM   2370 C  CD    . GLU F 3 27 ? 48.084  9.464   131.858 1.00 36.82 ? 345  GLU B CD    1 
ATOM   2371 O  OE1   . GLU F 3 27 ? 47.894  8.244   132.065 1.00 34.81 ? 345  GLU B OE1   1 
ATOM   2372 O  OE2   . GLU F 3 27 ? 48.411  9.951   130.743 1.00 37.07 ? 345  GLU B OE2   1 
ATOM   2373 N  N     . LEU F 3 28 ? 51.108  10.713  136.104 1.00 22.04 ? 346  LEU B N     1 
ATOM   2374 C  CA    . LEU F 3 28 ? 52.114  10.179  136.991 1.00 21.26 ? 346  LEU B CA    1 
ATOM   2375 C  C     . LEU F 3 28 ? 51.747  10.613  138.398 1.00 26.73 ? 346  LEU B C     1 
ATOM   2376 O  O     . LEU F 3 28 ? 51.861  9.838   139.328 1.00 35.09 ? 346  LEU B O     1 
ATOM   2377 C  CB    . LEU F 3 28 ? 53.500  10.731  136.656 1.00 20.45 ? 346  LEU B CB    1 
ATOM   2378 C  CG    . LEU F 3 28 ? 54.382  10.029  135.630 1.00 26.18 ? 346  LEU B CG    1 
ATOM   2379 C  CD1   . LEU F 3 28 ? 55.663  10.808  135.402 1.00 18.27 ? 346  LEU B CD1   1 
ATOM   2380 C  CD2   . LEU F 3 28 ? 54.699  8.650   136.121 1.00 22.47 ? 346  LEU B CD2   1 
ATOM   2381 N  N     . LYS F 3 29 ? 51.315  11.862  138.546 1.00 29.15 ? 347  LYS B N     1 
ATOM   2382 C  CA    . LYS F 3 29 ? 50.944  12.444  139.834 1.00 26.22 ? 347  LYS B CA    1 
ATOM   2383 C  C     . LYS F 3 29 ? 49.749  11.722  140.503 1.00 27.23 ? 347  LYS B C     1 
ATOM   2384 O  O     . LYS F 3 29 ? 49.757  11.418  141.694 1.00 30.02 ? 347  LYS B O     1 
ATOM   2385 C  CB    . LYS F 3 29 ? 50.683  13.938  139.622 1.00 24.88 ? 347  LYS B CB    1 
ATOM   2386 C  CG    . LYS F 3 29 ? 50.358  14.717  140.866 1.00 26.02 ? 347  LYS B CG    1 
ATOM   2387 C  CD    . LYS F 3 29 ? 48.934  15.179  140.837 1.00 27.64 ? 347  LYS B CD    1 
ATOM   2388 C  CE    . LYS F 3 29 ? 48.398  15.423  142.229 1.00 29.82 ? 347  LYS B CE    1 
ATOM   2389 N  NZ    . LYS F 3 29 ? 46.915  15.617  142.215 1.00 29.27 ? 347  LYS B NZ    1 
ATOM   2390 N  N     . ASP F 3 30 ? 48.746  11.400  139.707 1.00 30.73 ? 348  ASP B N     1 
ATOM   2391 C  CA    . ASP F 3 30 ? 47.578  10.704  140.183 1.00 25.65 ? 348  ASP B CA    1 
ATOM   2392 C  C     . ASP F 3 30 ? 47.989  9.330   140.682 1.00 30.73 ? 348  ASP B C     1 
ATOM   2393 O  O     . ASP F 3 30 ? 47.370  8.761   141.570 1.00 39.13 ? 348  ASP B O     1 
ATOM   2394 C  CB    . ASP F 3 30 ? 46.588  10.556  139.039 1.00 25.10 ? 348  ASP B CB    1 
ATOM   2395 C  CG    . ASP F 3 30 ? 45.804  11.822  138.764 1.00 33.45 ? 348  ASP B CG    1 
ATOM   2396 O  OD1   . ASP F 3 30 ? 46.008  12.861  139.428 1.00 31.35 ? 348  ASP B OD1   1 
ATOM   2397 O  OD2   . ASP F 3 30 ? 44.939  11.763  137.874 1.00 40.58 ? 348  ASP B OD2   1 
ATOM   2398 N  N     . LEU F 3 31 ? 49.020  8.790   140.062 1.00 31.99 ? 349  LEU B N     1 
ATOM   2399 C  CA    . LEU F 3 31 ? 49.558  7.485   140.389 1.00 26.45 ? 349  LEU B CA    1 
ATOM   2400 C  C     . LEU F 3 31 ? 50.343  7.484   141.665 1.00 31.67 ? 349  LEU B C     1 
ATOM   2401 O  O     . LEU F 3 31 ? 50.336  6.493   142.373 1.00 40.81 ? 349  LEU B O     1 
ATOM   2402 C  CB    . LEU F 3 31 ? 50.527  7.035   139.295 1.00 30.87 ? 349  LEU B CB    1 
ATOM   2403 C  CG    . LEU F 3 31 ? 50.119  5.966   138.308 1.00 28.47 ? 349  LEU B CG    1 
ATOM   2404 C  CD1   . LEU F 3 31 ? 51.282  5.607   137.428 1.00 30.60 ? 349  LEU B CD1   1 
ATOM   2405 C  CD2   . LEU F 3 31 ? 49.747  4.767   139.120 1.00 40.90 ? 349  LEU B CD2   1 
ATOM   2406 N  N     . VAL F 3 32 ? 51.090  8.550   141.929 1.00 29.15 ? 350  VAL B N     1 
ATOM   2407 C  CA    . VAL F 3 32 ? 51.924  8.578   143.107 1.00 26.04 ? 350  VAL B CA    1 
ATOM   2408 C  C     . VAL F 3 32 ? 51.383  9.354   144.317 1.00 31.14 ? 350  VAL B C     1 
ATOM   2409 O  O     . VAL F 3 32 ? 51.931  9.247   145.410 1.00 36.51 ? 350  VAL B O     1 
ATOM   2410 C  CB    . VAL F 3 32 ? 53.401  9.045   142.778 1.00 27.12 ? 350  VAL B CB    1 
ATOM   2411 C  CG1   . VAL F 3 32 ? 54.001  8.193   141.701 1.00 19.30 ? 350  VAL B CG1   1 
ATOM   2412 C  CG2   . VAL F 3 32 ? 53.456  10.530  142.406 1.00 24.24 ? 350  VAL B CG2   1 
ATOM   2413 N  N     . VAL F 3 33 ? 50.394  10.214  144.154 1.00 27.97 ? 351  VAL B N     1 
ATOM   2414 C  CA    . VAL F 3 33 ? 49.914  10.909  145.331 1.00 19.73 ? 351  VAL B CA    1 
ATOM   2415 C  C     . VAL F 3 33 ? 48.454  11.043  145.214 1.00 21.69 ? 351  VAL B C     1 
ATOM   2416 O  O     . VAL F 3 33 ? 47.801  11.576  146.090 1.00 29.10 ? 351  VAL B O     1 
ATOM   2417 C  CB    . VAL F 3 33 ? 50.526  12.298  145.516 1.00 24.09 ? 351  VAL B CB    1 
ATOM   2418 C  CG1   . VAL F 3 33 ? 52.057  12.207  145.571 1.00 20.21 ? 351  VAL B CG1   1 
ATOM   2419 C  CG2   . VAL F 3 33 ? 50.030  13.258  144.460 1.00 21.99 ? 351  VAL B CG2   1 
ATOM   2420 N  N     . GLY F 3 34 ? 47.926  10.553  144.110 1.00 27.49 ? 352  GLY B N     1 
ATOM   2421 C  CA    . GLY F 3 34 ? 46.503  10.633  143.914 1.00 27.72 ? 352  GLY B CA    1 
ATOM   2422 C  C     . GLY F 3 34 ? 46.018  11.955  143.361 1.00 30.60 ? 352  GLY B C     1 
ATOM   2423 O  O     . GLY F 3 34 ? 46.760  12.913  143.150 1.00 31.73 ? 352  GLY B O     1 
ATOM   2424 N  N     . THR F 3 35 ? 44.711  11.985  143.202 1.00 30.62 ? 353  THR B N     1 
ATOM   2425 C  CA    . THR F 3 35 ? 43.972  13.070  142.635 1.00 29.87 ? 353  THR B CA    1 
ATOM   2426 C  C     . THR F 3 35 ? 43.686  14.303  143.478 1.00 31.82 ? 353  THR B C     1 
ATOM   2427 O  O     . THR F 3 35 ? 43.757  15.417  142.976 1.00 35.24 ? 353  THR B O     1 
ATOM   2428 C  CB    . THR F 3 35 ? 42.719  12.454  142.065 1.00 24.71 ? 353  THR B CB    1 
ATOM   2429 O  OG1   . THR F 3 35 ? 43.017  11.948  140.754 1.00 31.56 ? 353  THR B OG1   1 
ATOM   2430 C  CG2   . THR F 3 35 ? 41.611  13.401  142.032 1.00 29.66 ? 353  THR B CG2   1 
ATOM   2431 N  N     . GLU F 3 36 ? 43.405  14.120  144.762 1.00 36.44 ? 354  GLU B N     1 
ATOM   2432 C  CA    . GLU F 3 36 ? 43.077  15.253  145.620 1.00 34.06 ? 354  GLU B CA    1 
ATOM   2433 C  C     . GLU F 3 36 ? 44.284  16.085  145.919 1.00 32.15 ? 354  GLU B C     1 
ATOM   2434 O  O     . GLU F 3 36 ? 44.170  17.294  146.072 1.00 41.47 ? 354  GLU B O     1 
ATOM   2435 C  CB    . GLU F 3 36 ? 42.404  14.816  146.923 1.00 37.36 ? 354  GLU B CB    1 
ATOM   2436 C  CG    . GLU F 3 36 ? 41.065  14.118  146.727 1.00 44.92 ? 354  GLU B CG    1 
ATOM   2437 C  CD    . GLU F 3 36 ? 40.146  14.184  147.945 1.00 59.32 ? 354  GLU B CD    1 
ATOM   2438 O  OE1   . GLU F 3 36 ? 40.411  13.461  148.936 1.00 60.61 ? 354  GLU B OE1   1 
ATOM   2439 O  OE2   . GLU F 3 36 ? 39.143  14.944  147.896 1.00 58.74 ? 354  GLU B OE2   1 
ATOM   2440 N  N     . ALA F 3 37 ? 45.455  15.469  145.950 1.00 32.92 ? 355  ALA B N     1 
ATOM   2441 C  CA    . ALA F 3 37 ? 46.662  16.225  146.256 1.00 27.40 ? 355  ALA B CA    1 
ATOM   2442 C  C     . ALA F 3 37 ? 47.030  17.292  145.231 1.00 28.50 ? 355  ALA B C     1 
ATOM   2443 O  O     . ALA F 3 37 ? 46.489  17.356  144.121 1.00 28.80 ? 355  ALA B O     1 
ATOM   2444 C  CB    . ALA F 3 37 ? 47.828  15.285  146.469 1.00 25.26 ? 355  ALA B CB    1 
ATOM   2445 N  N     . LYS F 3 38 ? 47.886  18.194  145.672 1.00 28.94 ? 356  LYS B N     1 
ATOM   2446 C  CA    . LYS F 3 38 ? 48.405  19.247  144.837 1.00 29.81 ? 356  LYS B CA    1 
ATOM   2447 C  C     . LYS F 3 38 ? 49.881  19.019  145.048 1.00 28.55 ? 356  LYS B C     1 
ATOM   2448 O  O     . LYS F 3 38 ? 50.320  18.885  146.169 1.00 30.55 ? 356  LYS B O     1 
ATOM   2449 C  CB    . LYS F 3 38 ? 48.006  20.616  145.353 1.00 32.04 ? 356  LYS B CB    1 
ATOM   2450 C  CG    . LYS F 3 38 ? 46.542  20.923  145.187 1.00 40.92 ? 356  LYS B CG    1 
ATOM   2451 C  CD    . LYS F 3 38 ? 46.162  21.205  143.752 1.00 47.83 ? 356  LYS B CD    1 
ATOM   2452 C  CE    . LYS F 3 38 ? 44.686  21.599  143.661 1.00 56.20 ? 356  LYS B CE    1 
ATOM   2453 N  NZ    . LYS F 3 38 ? 44.223  21.818  142.257 1.00 58.49 ? 356  LYS B NZ    1 
ATOM   2454 N  N     . LEU F 3 39 ? 50.622  18.867  143.970 1.00 25.47 ? 357  LEU B N     1 
ATOM   2455 C  CA    . LEU F 3 39 ? 52.038  18.615  144.057 1.00 24.00 ? 357  LEU B CA    1 
ATOM   2456 C  C     . LEU F 3 39 ? 52.646  19.173  142.759 1.00 30.78 ? 357  LEU B C     1 
ATOM   2457 O  O     . LEU F 3 39 ? 52.070  19.029  141.660 1.00 37.41 ? 357  LEU B O     1 
ATOM   2458 C  CB    . LEU F 3 39 ? 52.259  17.113  144.172 1.00 19.08 ? 357  LEU B CB    1 
ATOM   2459 C  CG    . LEU F 3 39 ? 53.693  16.664  144.368 1.00 18.50 ? 357  LEU B CG    1 
ATOM   2460 C  CD1   . LEU F 3 39 ? 54.196  17.217  145.651 1.00 20.23 ? 357  LEU B CD1   1 
ATOM   2461 C  CD2   . LEU F 3 39 ? 53.791  15.162  144.327 1.00 19.55 ? 357  LEU B CD2   1 
ATOM   2462 N  N     . ASN F 3 40 ? 53.795  19.829  142.879 1.00 28.97 ? 358  ASN B N     1 
ATOM   2463 C  CA    . ASN F 3 40 ? 54.433  20.429  141.729 1.00 25.81 ? 358  ASN B CA    1 
ATOM   2464 C  C     . ASN F 3 40 ? 55.106  19.382  140.869 1.00 27.49 ? 358  ASN B C     1 
ATOM   2465 O  O     . ASN F 3 40 ? 55.498  18.316  141.348 1.00 25.55 ? 358  ASN B O     1 
ATOM   2466 C  CB    . ASN F 3 40 ? 55.445  21.464  142.183 1.00 23.25 ? 358  ASN B CB    1 
ATOM   2467 C  CG    . ASN F 3 40 ? 56.458  20.884  143.080 1.00 21.76 ? 358  ASN B CG    1 
ATOM   2468 O  OD1   . ASN F 3 40 ? 56.120  20.354  144.116 1.00 34.14 ? 358  ASN B OD1   1 
ATOM   2469 N  ND2   . ASN F 3 40 ? 57.706  20.907  142.672 1.00 28.05 ? 358  ASN B ND2   1 
ATOM   2470 N  N     . LYS F 3 41 ? 55.309  19.741  139.605 1.00 28.50 ? 359  LYS B N     1 
ATOM   2471 C  CA    . LYS F 3 41 ? 55.910  18.860  138.621 1.00 22.18 ? 359  LYS B CA    1 
ATOM   2472 C  C     . LYS F 3 41 ? 57.123  18.081  139.028 1.00 22.30 ? 359  LYS B C     1 
ATOM   2473 O  O     . LYS F 3 41 ? 57.135  16.861  138.877 1.00 29.03 ? 359  LYS B O     1 
ATOM   2474 C  CB    . LYS F 3 41 ? 56.216  19.613  137.339 1.00 20.73 ? 359  LYS B CB    1 
ATOM   2475 C  CG    . LYS F 3 41 ? 54.982  20.070  136.664 1.00 17.35 ? 359  LYS B CG    1 
ATOM   2476 C  CD    . LYS F 3 41 ? 55.271  20.848  135.426 1.00 15.82 ? 359  LYS B CD    1 
ATOM   2477 C  CE    . LYS F 3 41 ? 53.983  21.424  134.909 1.00 8.75  ? 359  LYS B CE    1 
ATOM   2478 N  NZ    . LYS F 3 41 ? 54.292  22.336  133.786 1.00 18.47 ? 359  LYS B NZ    1 
ATOM   2479 N  N     . SER F 3 42 ? 58.141  18.742  139.562 1.00 20.32 ? 360  SER B N     1 
ATOM   2480 C  CA    . SER F 3 42 ? 59.354  18.016  139.908 1.00 21.00 ? 360  SER B CA    1 
ATOM   2481 C  C     . SER F 3 42 ? 59.206  16.987  141.033 1.00 28.07 ? 360  SER B C     1 
ATOM   2482 O  O     . SER F 3 42 ? 59.933  15.975  141.084 1.00 28.53 ? 360  SER B O     1 
ATOM   2483 C  CB    . SER F 3 42 ? 60.481  18.992  140.201 1.00 24.14 ? 360  SER B CB    1 
ATOM   2484 O  OG    . SER F 3 42 ? 60.007  20.028  141.025 1.00 29.83 ? 360  SER B OG    1 
ATOM   2485 N  N     . ALA F 3 43 ? 58.237  17.210  141.913 1.00 28.65 ? 361  ALA B N     1 
ATOM   2486 C  CA    . ALA F 3 43 ? 58.026  16.315  143.031 1.00 23.30 ? 361  ALA B CA    1 
ATOM   2487 C  C     . ALA F 3 43 ? 57.326  15.098  142.502 1.00 22.86 ? 361  ALA B C     1 
ATOM   2488 O  O     . ALA F 3 43 ? 57.545  13.994  142.957 1.00 28.30 ? 361  ALA B O     1 
ATOM   2489 C  CB    . ALA F 3 43 ? 57.197  16.991  144.042 1.00 27.93 ? 361  ALA B CB    1 
ATOM   2490 N  N     . VAL F 3 44 ? 56.468  15.312  141.521 1.00 27.16 ? 362  VAL B N     1 
ATOM   2491 C  CA    . VAL F 3 44 ? 55.744  14.227  140.886 1.00 24.90 ? 362  VAL B CA    1 
ATOM   2492 C  C     . VAL F 3 44 ? 56.743  13.301  140.228 1.00 25.37 ? 362  VAL B C     1 
ATOM   2493 O  O     . VAL F 3 44 ? 56.655  12.096  140.353 1.00 27.13 ? 362  VAL B O     1 
ATOM   2494 C  CB    . VAL F 3 44 ? 54.814  14.771  139.815 1.00 25.37 ? 362  VAL B CB    1 
ATOM   2495 C  CG1   . VAL F 3 44 ? 54.197  13.661  139.047 1.00 24.37 ? 362  VAL B CG1   1 
ATOM   2496 C  CG2   . VAL F 3 44 ? 53.763  15.612  140.452 1.00 21.11 ? 362  VAL B CG2   1 
ATOM   2497 N  N     . LEU F 3 45 ? 57.712  13.890  139.538 1.00 31.26 ? 363  LEU B N     1 
ATOM   2498 C  CA    . LEU F 3 45 ? 58.747  13.138  138.837 1.00 25.11 ? 363  LEU B CA    1 
ATOM   2499 C  C     . LEU F 3 45 ? 59.708  12.470  139.824 1.00 25.80 ? 363  LEU B C     1 
ATOM   2500 O  O     . LEU F 3 45 ? 60.038  11.301  139.663 1.00 28.94 ? 363  LEU B O     1 
ATOM   2501 C  CB    . LEU F 3 45 ? 59.473  14.051  137.835 1.00 20.71 ? 363  LEU B CB    1 
ATOM   2502 C  CG    . LEU F 3 45 ? 58.570  14.688  136.764 1.00 15.69 ? 363  LEU B CG    1 
ATOM   2503 C  CD1   . LEU F 3 45 ? 59.302  15.694  135.964 1.00 19.80 ? 363  LEU B CD1   1 
ATOM   2504 C  CD2   . LEU F 3 45 ? 58.021  13.680  135.839 1.00 17.43 ? 363  LEU B CD2   1 
ATOM   2505 N  N     . ARG F 3 46 ? 60.111  13.196  140.866 1.00 25.62 ? 364  ARG B N     1 
ATOM   2506 C  CA    . ARG F 3 46 ? 61.003  12.679  141.921 1.00 21.30 ? 364  ARG B CA    1 
ATOM   2507 C  C     . ARG F 3 46 ? 60.371  11.431  142.559 1.00 21.55 ? 364  ARG B C     1 
ATOM   2508 O  O     . ARG F 3 46 ? 61.009  10.406  142.758 1.00 23.02 ? 364  ARG B O     1 
ATOM   2509 C  CB    . ARG F 3 46 ? 61.190  13.778  142.971 1.00 26.91 ? 364  ARG B CB    1 
ATOM   2510 C  CG    . ARG F 3 46 ? 62.053  13.455  144.173 1.00 27.55 ? 364  ARG B CG    1 
ATOM   2511 C  CD    . ARG F 3 46 ? 63.512  13.396  143.785 1.00 43.39 ? 364  ARG B CD    1 
ATOM   2512 N  NE    . ARG F 3 46 ? 63.909  12.050  143.368 1.00 50.95 ? 364  ARG B NE    1 
ATOM   2513 C  CZ    . ARG F 3 46 ? 64.715  11.788  142.343 1.00 55.10 ? 364  ARG B CZ    1 
ATOM   2514 N  NH1   . ARG F 3 46 ? 65.208  12.790  141.610 1.00 53.86 ? 364  ARG B NH1   1 
ATOM   2515 N  NH2   . ARG F 3 46 ? 65.057  10.525  142.081 1.00 52.96 ? 364  ARG B NH2   1 
ATOM   2516 N  N     . LYS F 3 47 ? 59.080  11.518  142.834 1.00 24.78 ? 365  LYS B N     1 
ATOM   2517 C  CA    . LYS F 3 47 ? 58.339  10.422  143.428 1.00 24.54 ? 365  LYS B CA    1 
ATOM   2518 C  C     . LYS F 3 47 ? 58.263  9.277   142.474 1.00 23.09 ? 365  LYS B C     1 
ATOM   2519 O  O     . LYS F 3 47 ? 58.502  8.150   142.868 1.00 32.68 ? 365  LYS B O     1 
ATOM   2520 C  CB    . LYS F 3 47 ? 56.922  10.860  143.779 1.00 33.06 ? 365  LYS B CB    1 
ATOM   2521 C  CG    . LYS F 3 47 ? 56.797  11.500  145.126 1.00 35.34 ? 365  LYS B CG    1 
ATOM   2522 C  CD    . LYS F 3 47 ? 55.423  12.104  145.300 1.00 44.48 ? 365  LYS B CD    1 
ATOM   2523 C  CE    . LYS F 3 47 ? 55.253  12.641  146.716 1.00 45.45 ? 365  LYS B CE    1 
ATOM   2524 N  NZ    . LYS F 3 47 ? 55.116  11.509  147.691 1.00 55.13 ? 365  LYS B NZ    1 
ATOM   2525 N  N     . ALA F 3 48 ? 57.858  9.564   141.236 1.00 26.79 ? 366  ALA B N     1 
ATOM   2526 C  CA    . ALA F 3 48 ? 57.740  8.550   140.185 1.00 23.72 ? 366  ALA B CA    1 
ATOM   2527 C  C     . ALA F 3 48 ? 59.059  7.781   140.101 1.00 23.86 ? 366  ALA B C     1 
ATOM   2528 O  O     . ALA F 3 48 ? 59.086  6.546   140.207 1.00 30.74 ? 366  ALA B O     1 
ATOM   2529 C  CB    . ALA F 3 48 ? 57.397  9.211   138.829 1.00 14.31 ? 366  ALA B CB    1 
ATOM   2530 N  N     . ILE F 3 49 ? 60.161  8.514   139.983 1.00 24.00 ? 367  ILE B N     1 
ATOM   2531 C  CA    . ILE F 3 49 ? 61.475  7.893   139.904 1.00 17.96 ? 367  ILE B CA    1 
ATOM   2532 C  C     . ILE F 3 49 ? 61.700  7.011   141.106 1.00 21.55 ? 367  ILE B C     1 
ATOM   2533 O  O     . ILE F 3 49 ? 61.983  5.821   140.972 1.00 30.77 ? 367  ILE B O     1 
ATOM   2534 C  CB    . ILE F 3 49 ? 62.594  8.940   139.849 1.00 15.72 ? 367  ILE B CB    1 
ATOM   2535 C  CG1   . ILE F 3 49 ? 62.407  9.822   138.634 1.00 13.55 ? 367  ILE B CG1   1 
ATOM   2536 C  CG2   . ILE F 3 49 ? 63.914  8.270   139.748 1.00 19.56 ? 367  ILE B CG2   1 
ATOM   2537 C  CD1   . ILE F 3 49 ? 63.358  10.939  138.527 1.00 22.51 ? 367  ILE B CD1   1 
ATOM   2538 N  N     . ASP F 3 50 ? 61.511  7.572   142.291 1.00 26.03 ? 368  ASP B N     1 
ATOM   2539 C  CA    . ASP F 3 50 ? 61.748  6.823   143.510 1.00 22.11 ? 368  ASP B CA    1 
ATOM   2540 C  C     . ASP F 3 50 ? 60.818  5.640   143.640 1.00 20.74 ? 368  ASP B C     1 
ATOM   2541 O  O     . ASP F 3 50 ? 61.232  4.566   144.080 1.00 28.00 ? 368  ASP B O     1 
ATOM   2542 C  CB    . ASP F 3 50 ? 61.622  7.737   144.716 1.00 28.25 ? 368  ASP B CB    1 
ATOM   2543 C  CG    . ASP F 3 50 ? 62.670  8.846   144.738 1.00 36.37 ? 368  ASP B CG    1 
ATOM   2544 O  OD1   . ASP F 3 50 ? 63.700  8.753   144.014 1.00 37.73 ? 368  ASP B OD1   1 
ATOM   2545 O  OD2   . ASP F 3 50 ? 62.455  9.815   145.508 1.00 42.52 ? 368  ASP B OD2   1 
ATOM   2546 N  N     . TYR F 3 51 ? 59.591  5.801   143.168 1.00 20.47 ? 369  TYR B N     1 
ATOM   2547 C  CA    . TYR F 3 51 ? 58.600  4.737   143.245 1.00 16.57 ? 369  TYR B CA    1 
ATOM   2548 C  C     . TYR F 3 51 ? 58.954  3.580   142.390 1.00 19.35 ? 369  TYR B C     1 
ATOM   2549 O  O     . TYR F 3 51 ? 58.668  2.459   142.734 1.00 26.91 ? 369  TYR B O     1 
ATOM   2550 C  CB    . TYR F 3 51 ? 57.255  5.220   142.788 1.00 15.97 ? 369  TYR B CB    1 
ATOM   2551 C  CG    . TYR F 3 51 ? 56.170  4.238   143.116 1.00 21.05 ? 369  TYR B CG    1 
ATOM   2552 C  CD1   . TYR F 3 51 ? 56.269  3.386   144.222 1.00 21.95 ? 369  TYR B CD1   1 
ATOM   2553 C  CD2   . TYR F 3 51 ? 55.014  4.187   142.358 1.00 24.79 ? 369  TYR B CD2   1 
ATOM   2554 C  CE1   . TYR F 3 51 ? 55.238  2.525   144.541 1.00 19.87 ? 369  TYR B CE1   1 
ATOM   2555 C  CE2   . TYR F 3 51 ? 53.984  3.330   142.672 1.00 24.06 ? 369  TYR B CE2   1 
ATOM   2556 C  CZ    . TYR F 3 51 ? 54.099  2.512   143.749 1.00 23.50 ? 369  TYR B CZ    1 
ATOM   2557 O  OH    . TYR F 3 51 ? 53.056  1.664   143.989 1.00 27.17 ? 369  TYR B OH    1 
ATOM   2558 N  N     . ILE F 3 52 ? 59.446  3.879   141.198 1.00 28.03 ? 370  ILE B N     1 
ATOM   2559 C  CA    . ILE F 3 52 ? 59.859  2.865   140.227 1.00 26.96 ? 370  ILE B CA    1 
ATOM   2560 C  C     . ILE F 3 52 ? 61.035  2.098   140.808 1.00 24.06 ? 370  ILE B C     1 
ATOM   2561 O  O     . ILE F 3 52 ? 61.058  0.870   140.769 1.00 26.88 ? 370  ILE B O     1 
ATOM   2562 C  CB    . ILE F 3 52 ? 60.278  3.523   138.855 1.00 25.74 ? 370  ILE B CB    1 
ATOM   2563 C  CG1   . ILE F 3 52 ? 59.034  4.016   138.110 1.00 24.37 ? 370  ILE B CG1   1 
ATOM   2564 C  CG2   . ILE F 3 52 ? 61.100  2.553   138.018 1.00 23.78 ? 370  ILE B CG2   1 
ATOM   2565 C  CD1   . ILE F 3 52 ? 59.325  4.787   136.848 1.00 31.65 ? 370  ILE B CD1   1 
ATOM   2566 N  N     . ARG F 3 53 ? 62.004  2.831   141.343 1.00 23.18 ? 371  ARG B N     1 
ATOM   2567 C  CA    . ARG F 3 53 ? 63.179  2.222   141.941 1.00 24.82 ? 371  ARG B CA    1 
ATOM   2568 C  C     . ARG F 3 53 ? 62.782  1.347   143.114 1.00 27.26 ? 371  ARG B C     1 
ATOM   2569 O  O     . ARG F 3 53 ? 63.322  0.252   143.320 1.00 31.39 ? 371  ARG B O     1 
ATOM   2570 C  CB    . ARG F 3 53 ? 64.135  3.299   142.398 1.00 26.01 ? 371  ARG B CB    1 
ATOM   2571 C  CG    . ARG F 3 53 ? 64.625  4.135   141.249 1.00 32.95 ? 371  ARG B CG    1 
ATOM   2572 C  CD    . ARG F 3 53 ? 65.851  4.946   141.611 1.00 33.09 ? 371  ARG B CD    1 
ATOM   2573 N  NE    . ARG F 3 53 ? 66.424  5.573   140.425 1.00 38.02 ? 371  ARG B NE    1 
ATOM   2574 C  CZ    . ARG F 3 53 ? 66.769  6.851   140.344 1.00 38.82 ? 371  ARG B CZ    1 
ATOM   2575 N  NH1   . ARG F 3 53 ? 66.608  7.669   141.384 1.00 40.09 ? 371  ARG B NH1   1 
ATOM   2576 N  NH2   . ARG F 3 53 ? 67.258  7.315   139.205 1.00 39.15 ? 371  ARG B NH2   1 
ATOM   2577 N  N     . PHE F 3 54 ? 61.799  1.818   143.862 1.00 30.46 ? 372  PHE B N     1 
ATOM   2578 C  CA    . PHE F 3 54 ? 61.296  1.079   144.998 1.00 26.15 ? 372  PHE B CA    1 
ATOM   2579 C  C     . PHE F 3 54 ? 60.679  -0.246  144.558 1.00 26.88 ? 372  PHE B C     1 
ATOM   2580 O  O     . PHE F 3 54 ? 61.084  -1.309  145.028 1.00 31.88 ? 372  PHE B O     1 
ATOM   2581 C  CB    . PHE F 3 54 ? 60.303  1.946   145.770 1.00 29.55 ? 372  PHE B CB    1 
ATOM   2582 C  CG    . PHE F 3 54 ? 59.492  1.190   146.739 1.00 31.22 ? 372  PHE B CG    1 
ATOM   2583 C  CD1   . PHE F 3 54 ? 60.085  0.610   147.841 1.00 32.17 ? 372  PHE B CD1   1 
ATOM   2584 C  CD2   . PHE F 3 54 ? 58.138  1.003   146.519 1.00 32.88 ? 372  PHE B CD2   1 
ATOM   2585 C  CE1   . PHE F 3 54 ? 59.336  -0.150  148.698 1.00 35.79 ? 372  PHE B CE1   1 
ATOM   2586 C  CE2   . PHE F 3 54 ? 57.380  0.242   147.376 1.00 32.65 ? 372  PHE B CE2   1 
ATOM   2587 C  CZ    . PHE F 3 54 ? 57.970  -0.335  148.462 1.00 34.66 ? 372  PHE B CZ    1 
ATOM   2588 N  N     . LEU F 3 55 ? 59.751  -0.190  143.605 1.00 27.72 ? 373  LEU B N     1 
ATOM   2589 C  CA    . LEU F 3 55 ? 59.082  -1.385  143.097 1.00 18.79 ? 373  LEU B CA    1 
ATOM   2590 C  C     . LEU F 3 55 ? 60.071  -2.269  142.394 1.00 22.24 ? 373  LEU B C     1 
ATOM   2591 O  O     . LEU F 3 55 ? 59.926  -3.483  142.368 1.00 26.19 ? 373  LEU B O     1 
ATOM   2592 C  CB    . LEU F 3 55 ? 57.969  -1.008  142.130 1.00 19.05 ? 373  LEU B CB    1 
ATOM   2593 C  CG    . LEU F 3 55 ? 56.752  -0.327  142.748 1.00 21.26 ? 373  LEU B CG    1 
ATOM   2594 C  CD1   . LEU F 3 55 ? 55.771  0.154   141.703 1.00 9.92  ? 373  LEU B CD1   1 
ATOM   2595 C  CD2   . LEU F 3 55 ? 56.114  -1.322  143.668 1.00 17.36 ? 373  LEU B CD2   1 
ATOM   2596 N  N     . GLN F 3 56 ? 61.076  -1.670  141.789 1.00 22.40 ? 374  GLN B N     1 
ATOM   2597 C  CA    . GLN F 3 56 ? 62.054  -2.474  141.097 1.00 23.62 ? 374  GLN B CA    1 
ATOM   2598 C  C     . GLN F 3 56 ? 62.756  -3.342  142.114 1.00 27.20 ? 374  GLN B C     1 
ATOM   2599 O  O     . GLN F 3 56 ? 62.773  -4.555  141.999 1.00 28.82 ? 374  GLN B O     1 
ATOM   2600 C  CB    . GLN F 3 56 ? 63.014  -1.590  140.299 1.00 28.62 ? 374  GLN B CB    1 
ATOM   2601 C  CG    . GLN F 3 56 ? 62.585  -1.433  138.826 1.00 25.00 ? 374  GLN B CG    1 
ATOM   2602 C  CD    . GLN F 3 56 ? 63.378  -0.394  138.067 1.00 28.49 ? 374  GLN B CD    1 
ATOM   2603 O  OE1   . GLN F 3 56 ? 64.214  0.303   138.635 1.00 32.04 ? 374  GLN B OE1   1 
ATOM   2604 N  NE2   . GLN F 3 56 ? 63.048  -0.216  136.799 1.00 24.97 ? 374  GLN B NE2   1 
ATOM   2605 N  N     . HIS F 3 57 ? 63.244  -2.734  143.179 1.00 32.40 ? 375  HIS B N     1 
ATOM   2606 C  CA    . HIS F 3 57 ? 63.898  -3.502  144.215 1.00 30.00 ? 375  HIS B CA    1 
ATOM   2607 C  C     . HIS F 3 57 ? 62.959  -4.494  144.890 1.00 31.19 ? 375  HIS B C     1 
ATOM   2608 O  O     . HIS F 3 57 ? 63.344  -5.638  145.139 1.00 38.00 ? 375  HIS B O     1 
ATOM   2609 C  CB    . HIS F 3 57 ? 64.506  -2.568  145.228 1.00 38.01 ? 375  HIS B CB    1 
ATOM   2610 C  CG    . HIS F 3 57 ? 65.746  -1.899  144.733 1.00 55.59 ? 375  HIS B CG    1 
ATOM   2611 N  ND1   . HIS F 3 57 ? 65.874  -0.528  144.643 1.00 60.08 ? 375  HIS B ND1   1 
ATOM   2612 C  CD2   . HIS F 3 57 ? 66.907  -2.418  144.258 1.00 57.10 ? 375  HIS B CD2   1 
ATOM   2613 C  CE1   . HIS F 3 57 ? 67.058  -0.231  144.131 1.00 61.61 ? 375  HIS B CE1   1 
ATOM   2614 N  NE2   . HIS F 3 57 ? 67.704  -1.359  143.889 1.00 65.16 ? 375  HIS B NE2   1 
ATOM   2615 N  N     . SER F 3 58 ? 61.717  -4.097  145.137 1.00 28.72 ? 376  SER B N     1 
ATOM   2616 C  CA    . SER F 3 58 ? 60.758  -4.986  145.785 1.00 25.41 ? 376  SER B CA    1 
ATOM   2617 C  C     . SER F 3 58 ? 60.470  -6.219  144.954 1.00 26.29 ? 376  SER B C     1 
ATOM   2618 O  O     . SER F 3 58 ? 60.330  -7.332  145.456 1.00 32.44 ? 376  SER B O     1 
ATOM   2619 C  CB    . SER F 3 58 ? 59.455  -4.244  146.054 1.00 24.15 ? 376  SER B CB    1 
ATOM   2620 O  OG    . SER F 3 58 ? 59.702  -3.059  146.795 1.00 34.14 ? 376  SER B OG    1 
ATOM   2621 N  N     . ASN F 3 59 ? 60.370  -6.017  143.661 1.00 30.95 ? 377  ASN B N     1 
ATOM   2622 C  CA    . ASN F 3 59 ? 60.080  -7.104  142.783 1.00 23.21 ? 377  ASN B CA    1 
ATOM   2623 C  C     . ASN F 3 59 ? 61.308  -7.985  142.630 1.00 22.87 ? 377  ASN B C     1 
ATOM   2624 O  O     . ASN F 3 59 ? 61.166  -9.194  142.568 1.00 26.15 ? 377  ASN B O     1 
ATOM   2625 C  CB    . ASN F 3 59 ? 59.560  -6.559  141.456 1.00 25.52 ? 377  ASN B CB    1 
ATOM   2626 C  CG    . ASN F 3 59 ? 58.216  -5.830  141.592 1.00 26.69 ? 377  ASN B CG    1 
ATOM   2627 O  OD1   . ASN F 3 59 ? 57.584  -5.866  142.636 1.00 27.91 ? 377  ASN B OD1   1 
ATOM   2628 N  ND2   . ASN F 3 59 ? 57.766  -5.200  140.510 1.00 26.18 ? 377  ASN B ND2   1 
ATOM   2629 N  N     . GLN F 3 60 ? 62.510  -7.406  142.626 1.00 28.69 ? 378  GLN B N     1 
ATOM   2630 C  CA    . GLN F 3 60 ? 63.736  -8.217  142.492 1.00 35.99 ? 378  GLN B CA    1 
ATOM   2631 C  C     . GLN F 3 60 ? 63.729  -9.116  143.700 1.00 35.25 ? 378  GLN B C     1 
ATOM   2632 O  O     . GLN F 3 60 ? 63.589  -10.321 143.584 1.00 42.19 ? 378  GLN B O     1 
ATOM   2633 C  CB    . GLN F 3 60 ? 65.037  -7.412  142.577 1.00 39.09 ? 378  GLN B CB    1 
ATOM   2634 C  CG    . GLN F 3 60 ? 65.240  -6.270  141.591 1.00 61.35 ? 378  GLN B CG    1 
ATOM   2635 C  CD    . GLN F 3 60 ? 66.265  -5.216  142.102 1.00 71.31 ? 378  GLN B CD    1 
ATOM   2636 O  OE1   . GLN F 3 60 ? 66.222  -4.029  141.716 1.00 69.56 ? 378  GLN B OE1   1 
ATOM   2637 N  NE2   . GLN F 3 60 ? 67.169  -5.648  142.995 1.00 66.86 ? 378  GLN B NE2   1 
ATOM   2638 N  N     . LYS F 3 61 ? 63.811  -8.510  144.873 1.00 34.28 ? 379  LYS B N     1 
ATOM   2639 C  CA    . LYS F 3 61 ? 63.830  -9.267  146.109 1.00 38.14 ? 379  LYS B CA    1 
ATOM   2640 C  C     . LYS F 3 61 ? 62.780  -10.373 146.111 1.00 36.20 ? 379  LYS B C     1 
ATOM   2641 O  O     . LYS F 3 61 ? 63.086  -11.526 146.393 1.00 39.72 ? 379  LYS B O     1 
ATOM   2642 C  CB    . LYS F 3 61 ? 63.652  -8.326  147.300 1.00 43.11 ? 379  LYS B CB    1 
ATOM   2643 C  CG    . LYS F 3 61 ? 63.826  -8.998  148.646 1.00 58.73 ? 379  LYS B CG    1 
ATOM   2644 C  CD    . LYS F 3 61 ? 65.097  -9.867  148.675 1.00 61.78 ? 379  LYS B CD    1 
ATOM   2645 C  CE    . LYS F 3 61 ? 65.624  -10.042 150.100 1.00 61.63 ? 379  LYS B CE    1 
ATOM   2646 N  NZ    . LYS F 3 61 ? 66.214  -8.768  150.652 1.00 64.75 ? 379  LYS B NZ    1 
ATOM   2647 N  N     . LEU F 3 62 ? 61.567  -10.047 145.692 1.00 38.74 ? 380  LEU B N     1 
ATOM   2648 C  CA    . LEU F 3 62 ? 60.500  -11.031 145.654 1.00 38.30 ? 380  LEU B CA    1 
ATOM   2649 C  C     . LEU F 3 62 ? 60.794  -12.157 144.670 1.00 41.76 ? 380  LEU B C     1 
ATOM   2650 O  O     . LEU F 3 62 ? 60.463  -13.313 144.924 1.00 44.96 ? 380  LEU B O     1 
ATOM   2651 C  CB    . LEU F 3 62 ? 59.186  -10.355 145.302 1.00 34.15 ? 380  LEU B CB    1 
ATOM   2652 C  CG    . LEU F 3 62 ? 58.350  -9.855  146.470 1.00 30.71 ? 380  LEU B CG    1 
ATOM   2653 C  CD1   . LEU F 3 62 ? 57.188  -9.013  145.956 1.00 33.73 ? 380  LEU B CD1   1 
ATOM   2654 C  CD2   . LEU F 3 62 ? 57.820  -11.047 147.248 1.00 28.30 ? 380  LEU B CD2   1 
ATOM   2655 N  N     . LYS F 3 63 ? 61.421  -11.820 143.547 1.00 43.72 ? 381  LYS B N     1 
ATOM   2656 C  CA    . LYS F 3 63 ? 61.766  -12.804 142.530 1.00 39.87 ? 381  LYS B CA    1 
ATOM   2657 C  C     . LYS F 3 63 ? 62.918  -13.705 142.976 1.00 37.17 ? 381  LYS B C     1 
ATOM   2658 O  O     . LYS F 3 63 ? 62.954  -14.889 142.636 1.00 37.46 ? 381  LYS B O     1 
ATOM   2659 C  CB    . LYS F 3 63 ? 62.132  -12.116 141.217 1.00 38.76 ? 381  LYS B CB    1 
ATOM   2660 C  CG    . LYS F 3 63 ? 60.960  -11.608 140.410 1.00 45.04 ? 381  LYS B CG    1 
ATOM   2661 C  CD    . LYS F 3 63 ? 61.477  -10.888 139.172 1.00 45.77 ? 381  LYS B CD    1 
ATOM   2662 C  CE    . LYS F 3 63 ? 60.360  -10.197 138.409 1.00 48.39 ? 381  LYS B CE    1 
ATOM   2663 N  NZ    . LYS F 3 63 ? 60.864  -9.005  137.665 1.00 46.71 ? 381  LYS B NZ    1 
ATOM   2664 N  N     . GLN F 3 64 ? 63.874  -13.154 143.707 1.00 34.25 ? 382  GLN B N     1 
ATOM   2665 C  CA    . GLN F 3 64 ? 64.981  -13.962 144.167 1.00 38.25 ? 382  GLN B CA    1 
ATOM   2666 C  C     . GLN F 3 64 ? 64.476  -14.889 145.262 1.00 39.50 ? 382  GLN B C     1 
ATOM   2667 O  O     . GLN F 3 64 ? 64.865  -16.052 145.349 1.00 39.54 ? 382  GLN B O     1 
ATOM   2668 C  CB    . GLN F 3 64 ? 66.129  -13.096 144.670 1.00 44.25 ? 382  GLN B CB    1 
ATOM   2669 C  CG    . GLN F 3 64 ? 67.332  -13.934 145.187 1.00 62.66 ? 382  GLN B CG    1 
ATOM   2670 C  CD    . GLN F 3 64 ? 67.750  -15.102 144.245 1.00 69.36 ? 382  GLN B CD    1 
ATOM   2671 O  OE1   . GLN F 3 64 ? 67.644  -16.294 144.618 1.00 60.44 ? 382  GLN B OE1   1 
ATOM   2672 N  NE2   . GLN F 3 64 ? 68.226  -14.757 143.026 1.00 61.09 ? 382  GLN B NE2   1 
ATOM   2673 N  N     . GLU F 3 65 ? 63.569  -14.373 146.076 1.00 39.97 ? 383  GLU B N     1 
ATOM   2674 C  CA    . GLU F 3 65 ? 62.976  -15.156 147.142 1.00 34.23 ? 383  GLU B CA    1 
ATOM   2675 C  C     . GLU F 3 65 ? 62.095  -16.239 146.556 1.00 30.10 ? 383  GLU B C     1 
ATOM   2676 O  O     . GLU F 3 65 ? 62.037  -17.325 147.071 1.00 34.87 ? 383  GLU B O     1 
ATOM   2677 C  CB    . GLU F 3 65 ? 62.160  -14.258 148.034 1.00 33.70 ? 383  GLU B CB    1 
ATOM   2678 C  CG    . GLU F 3 65 ? 61.517  -14.975 149.164 1.00 45.45 ? 383  GLU B CG    1 
ATOM   2679 C  CD    . GLU F 3 65 ? 60.791  -14.027 150.068 1.00 49.14 ? 383  GLU B CD    1 
ATOM   2680 O  OE1   . GLU F 3 65 ? 61.383  -12.983 150.445 1.00 50.76 ? 383  GLU B OE1   1 
ATOM   2681 O  OE2   . GLU F 3 65 ? 59.617  -14.314 150.382 1.00 55.33 ? 383  GLU B OE2   1 
ATOM   2682 N  N     . ASN F 3 66 ? 61.360  -15.924 145.502 1.00 36.49 ? 384  ASN B N     1 
ATOM   2683 C  CA    . ASN F 3 66 ? 60.511  -16.919 144.848 1.00 37.42 ? 384  ASN B CA    1 
ATOM   2684 C  C     . ASN F 3 66 ? 61.423  -17.959 144.201 1.00 39.97 ? 384  ASN B C     1 
ATOM   2685 O  O     . ASN F 3 66 ? 61.061  -19.137 144.028 1.00 41.58 ? 384  ASN B O     1 
ATOM   2686 C  CB    . ASN F 3 66 ? 59.655  -16.284 143.757 1.00 34.66 ? 384  ASN B CB    1 
ATOM   2687 C  CG    . ASN F 3 66 ? 58.501  -15.491 144.295 1.00 35.70 ? 384  ASN B CG    1 
ATOM   2688 O  OD1   . ASN F 3 66 ? 57.704  -14.948 143.525 1.00 39.28 ? 384  ASN B OD1   1 
ATOM   2689 N  ND2   . ASN F 3 66 ? 58.394  -15.408 145.604 1.00 40.69 ? 384  ASN B ND2   1 
ATOM   2690 N  N     . LEU F 3 67 ? 62.593  -17.488 143.799 1.00 38.75 ? 385  LEU B N     1 
ATOM   2691 C  CA    . LEU F 3 67 ? 63.575  -18.342 143.188 1.00 43.53 ? 385  LEU B CA    1 
ATOM   2692 C  C     . LEU F 3 67 ? 63.927  -19.371 144.248 1.00 45.04 ? 385  LEU B C     1 
ATOM   2693 O  O     . LEU F 3 67 ? 63.602  -20.547 144.113 1.00 49.40 ? 385  LEU B O     1 
ATOM   2694 C  CB    . LEU F 3 67 ? 64.809  -17.514 142.799 1.00 45.31 ? 385  LEU B CB    1 
ATOM   2695 C  CG    . LEU F 3 67 ? 65.976  -18.242 142.139 1.00 45.22 ? 385  LEU B CG    1 
ATOM   2696 C  CD1   . LEU F 3 67 ? 65.470  -19.055 140.946 1.00 45.05 ? 385  LEU B CD1   1 
ATOM   2697 C  CD2   . LEU F 3 67 ? 67.017  -17.235 141.720 1.00 48.09 ? 385  LEU B CD2   1 
ATOM   2698 N  N     . SER F 3 68 ? 64.488  -18.889 145.349 1.00 46.06 ? 386  SER B N     1 
ATOM   2699 C  CA    . SER F 3 68 ? 64.900  -19.726 146.461 1.00 44.48 ? 386  SER B CA    1 
ATOM   2700 C  C     . SER F 3 68 ? 63.802  -20.663 146.917 1.00 44.42 ? 386  SER B C     1 
ATOM   2701 O  O     . SER F 3 68 ? 64.072  -21.801 147.282 1.00 47.81 ? 386  SER B O     1 
ATOM   2702 C  CB    . SER F 3 68 ? 65.325  -18.836 147.617 1.00 47.55 ? 386  SER B CB    1 
ATOM   2703 O  OG    . SER F 3 68 ? 66.286  -17.876 147.177 1.00 66.33 ? 386  SER B OG    1 
ATOM   2704 N  N     . LEU F 3 69 ? 62.566  -20.183 146.890 1.00 44.38 ? 387  LEU B N     1 
ATOM   2705 C  CA    . LEU F 3 69 ? 61.417  -20.979 147.302 1.00 43.14 ? 387  LEU B CA    1 
ATOM   2706 C  C     . LEU F 3 69 ? 61.159  -22.090 146.315 1.00 44.34 ? 387  LEU B C     1 
ATOM   2707 O  O     . LEU F 3 69 ? 60.805  -23.199 146.701 1.00 47.79 ? 387  LEU B O     1 
ATOM   2708 C  CB    . LEU F 3 69 ? 60.173  -20.104 147.437 1.00 38.19 ? 387  LEU B CB    1 
ATOM   2709 C  CG    . LEU F 3 69 ? 60.146  -19.267 148.703 1.00 30.63 ? 387  LEU B CG    1 
ATOM   2710 C  CD1   . LEU F 3 69 ? 59.254  -18.044 148.583 1.00 29.63 ? 387  LEU B CD1   1 
ATOM   2711 C  CD2   . LEU F 3 69 ? 59.673  -20.176 149.801 1.00 37.56 ? 387  LEU B CD2   1 
ATOM   2712 N  N     . ARG F 3 70 ? 61.301  -21.785 145.035 1.00 47.34 ? 388  ARG B N     1 
ATOM   2713 C  CA    . ARG F 3 70 ? 61.095  -22.796 144.021 1.00 48.96 ? 388  ARG B CA    1 
ATOM   2714 C  C     . ARG F 3 70 ? 62.232  -23.795 144.015 1.00 48.88 ? 388  ARG B C     1 
ATOM   2715 O  O     . ARG F 3 70 ? 61.994  -24.984 143.881 1.00 50.15 ? 388  ARG B O     1 
ATOM   2716 C  CB    . ARG F 3 70 ? 60.919  -22.163 142.660 1.00 51.38 ? 388  ARG B CB    1 
ATOM   2717 C  CG    . ARG F 3 70 ? 59.468  -21.872 142.351 1.00 50.41 ? 388  ARG B CG    1 
ATOM   2718 C  CD    . ARG F 3 70 ? 59.333  -21.436 140.924 1.00 45.64 ? 388  ARG B CD    1 
ATOM   2719 N  NE    . ARG F 3 70 ? 60.018  -20.168 140.725 1.00 40.60 ? 388  ARG B NE    1 
ATOM   2720 C  CZ    . ARG F 3 70 ? 59.369  -19.023 140.645 1.00 43.22 ? 388  ARG B CZ    1 
ATOM   2721 N  NH1   . ARG F 3 70 ? 58.032  -19.033 140.733 1.00 36.48 ? 388  ARG B NH1   1 
ATOM   2722 N  NH2   . ARG F 3 70 ? 60.050  -17.887 140.558 1.00 37.96 ? 388  ARG B NH2   1 
ATOM   2723 N  N     . THR F 3 71 ? 63.462  -23.311 144.164 1.00 53.01 ? 389  THR B N     1 
ATOM   2724 C  CA    . THR F 3 71 ? 64.631  -24.182 144.227 1.00 53.82 ? 389  THR B CA    1 
ATOM   2725 C  C     . THR F 3 71 ? 64.357  -25.133 145.388 1.00 56.56 ? 389  THR B C     1 
ATOM   2726 O  O     . THR F 3 71 ? 64.253  -26.322 145.170 1.00 63.80 ? 389  THR B O     1 
ATOM   2727 C  CB    . THR F 3 71 ? 65.918  -23.378 144.474 1.00 52.99 ? 389  THR B CB    1 
ATOM   2728 N  N     . ALA F 3 72 ? 64.158  -24.606 146.595 1.00 56.85 ? 390  ALA B N     1 
ATOM   2729 C  CA    . ALA F 3 72 ? 63.842  -25.435 147.766 1.00 53.16 ? 390  ALA B CA    1 
ATOM   2730 C  C     . ALA F 3 72 ? 62.805  -26.495 147.413 1.00 52.48 ? 390  ALA B C     1 
ATOM   2731 O  O     . ALA F 3 72 ? 63.043  -27.676 147.594 1.00 53.35 ? 390  ALA B O     1 
ATOM   2732 C  CB    . ALA F 3 72 ? 63.314  -24.567 148.914 1.00 54.76 ? 390  ALA B CB    1 
ATOM   2733 N  N     . VAL F 3 73 ? 61.669  -26.069 146.873 1.00 53.86 ? 391  VAL B N     1 
ATOM   2734 C  CA    . VAL F 3 73 ? 60.607  -27.000 146.489 1.00 56.52 ? 391  VAL B CA    1 
ATOM   2735 C  C     . VAL F 3 73 ? 61.118  -28.062 145.514 1.00 54.48 ? 391  VAL B C     1 
ATOM   2736 O  O     . VAL F 3 73 ? 60.778  -29.234 145.640 1.00 59.93 ? 391  VAL B O     1 
ATOM   2737 C  CB    . VAL F 3 73 ? 59.388  -26.264 145.831 1.00 60.28 ? 391  VAL B CB    1 
ATOM   2738 C  CG1   . VAL F 3 73 ? 58.389  -27.279 145.253 1.00 59.66 ? 391  VAL B CG1   1 
ATOM   2739 C  CG2   . VAL F 3 73 ? 58.680  -25.370 146.846 1.00 55.37 ? 391  VAL B CG2   1 
ATOM   2740 N  N     . HIS F 3 74 ? 61.903  -27.642 144.531 1.00 51.06 ? 392  HIS B N     1 
ATOM   2741 C  CA    . HIS F 3 74 ? 62.444  -28.567 143.549 1.00 53.95 ? 392  HIS B CA    1 
ATOM   2742 C  C     . HIS F 3 74 ? 63.440  -29.489 144.236 1.00 59.05 ? 392  HIS B C     1 
ATOM   2743 O  O     . HIS F 3 74 ? 63.371  -30.711 144.091 1.00 62.58 ? 392  HIS B O     1 
ATOM   2744 C  CB    . HIS F 3 74 ? 63.124  -27.809 142.416 1.00 48.20 ? 392  HIS B CB    1 
ATOM   2745 N  N     . LYS F 3 75 ? 64.327  -28.897 145.032 1.00 57.73 ? 393  LYS B N     1 
ATOM   2746 C  CA    . LYS F 3 75 ? 65.352  -29.630 145.758 1.00 52.89 ? 393  LYS B CA    1 
ATOM   2747 C  C     . LYS F 3 75 ? 64.709  -30.262 146.975 1.00 55.68 ? 393  LYS B C     1 
ATOM   2748 O  O     . LYS F 3 75 ? 65.297  -30.250 148.057 1.00 63.37 ? 393  LYS B O     1 
ATOM   2749 C  CB    . LYS F 3 75 ? 66.508  -28.699 146.177 1.00 42.98 ? 393  LYS B CB    1 
ATOM   2750 N  N     . SER F 3 76 ? 63.491  -30.776 146.790 1.00 55.23 ? 394  SER B N     1 
ATOM   2751 C  CA    . SER F 3 76 ? 62.708  -31.457 147.828 1.00 57.74 ? 394  SER B CA    1 
ATOM   2752 C  C     . SER F 3 76 ? 61.551  -32.184 147.136 1.00 55.75 ? 394  SER B C     1 
ATOM   2753 O  O     . SER F 3 76 ? 61.790  -32.706 146.018 1.00 57.01 ? 394  SER B O     1 
ATOM   2754 C  CB    . SER F 3 76 ? 62.171  -30.464 148.887 1.00 51.89 ? 394  SER B CB    1 
ATOM   2755 N  N     . GLN G 3 1  ? 64.948  45.271  165.377 1.00 57.06 ? 319  GLN C N     1 
ATOM   2756 C  CA    . GLN G 3 1  ? 64.610  45.250  166.837 1.00 48.99 ? 319  GLN C CA    1 
ATOM   2757 C  C     . GLN G 3 1  ? 65.080  44.019  167.590 1.00 47.38 ? 319  GLN C C     1 
ATOM   2758 O  O     . GLN G 3 1  ? 64.903  42.905  167.135 1.00 50.57 ? 319  GLN C O     1 
ATOM   2759 C  CB    . GLN G 3 1  ? 63.112  45.374  167.028 1.00 42.85 ? 319  GLN C CB    1 
ATOM   2760 C  CG    . GLN G 3 1  ? 62.566  46.672  166.576 1.00 42.09 ? 319  GLN C CG    1 
ATOM   2761 C  CD    . GLN G 3 1  ? 61.108  46.775  166.873 1.00 49.83 ? 319  GLN C CD    1 
ATOM   2762 O  OE1   . GLN G 3 1  ? 60.442  45.769  167.099 1.00 50.64 ? 319  GLN C OE1   1 
ATOM   2763 N  NE2   . GLN G 3 1  ? 60.588  47.993  166.879 1.00 57.52 ? 319  GLN C NE2   1 
ATOM   2764 N  N     . SER G 3 2  ? 65.610  44.224  168.783 1.00 46.35 ? 320  SER C N     1 
ATOM   2765 C  CA    . SER G 3 2  ? 66.069  43.131  169.620 1.00 47.94 ? 320  SER C CA    1 
ATOM   2766 C  C     . SER G 3 2  ? 64.862  42.808  170.488 1.00 50.07 ? 320  SER C C     1 
ATOM   2767 O  O     . SER G 3 2  ? 63.929  43.614  170.547 1.00 48.56 ? 320  SER C O     1 
ATOM   2768 C  CB    . SER G 3 2  ? 67.178  43.630  170.521 1.00 47.12 ? 320  SER C CB    1 
ATOM   2769 O  OG    . SER G 3 2  ? 66.701  44.702  171.314 1.00 42.78 ? 320  SER C OG    1 
ATOM   2770 N  N     . ARG G 3 3  ? 64.903  41.687  171.211 1.00 51.11 ? 321  ARG C N     1 
ATOM   2771 C  CA    . ARG G 3 3  ? 63.794  41.290  172.100 1.00 52.23 ? 321  ARG C CA    1 
ATOM   2772 C  C     . ARG G 3 3  ? 63.323  42.442  173.007 1.00 50.85 ? 321  ARG C C     1 
ATOM   2773 O  O     . ARG G 3 3  ? 62.129  42.767  173.061 1.00 53.57 ? 321  ARG C O     1 
ATOM   2774 C  CB    . ARG G 3 3  ? 64.186  40.087  172.953 1.00 46.74 ? 321  ARG C CB    1 
ATOM   2775 N  N     . GLY G 3 4  ? 64.264  43.071  173.697 1.00 47.11 ? 322  GLY C N     1 
ATOM   2776 C  CA    . GLY G 3 4  ? 63.908  44.166  174.567 1.00 45.17 ? 322  GLY C CA    1 
ATOM   2777 C  C     . GLY G 3 4  ? 63.290  45.291  173.776 1.00 45.80 ? 322  GLY C C     1 
ATOM   2778 O  O     . GLY G 3 4  ? 62.333  45.920  174.222 1.00 48.76 ? 322  GLY C O     1 
ATOM   2779 N  N     . GLU G 3 5  ? 63.827  45.528  172.584 1.00 46.03 ? 323  GLU C N     1 
ATOM   2780 C  CA    . GLU G 3 5  ? 63.332  46.582  171.721 1.00 41.05 ? 323  GLU C CA    1 
ATOM   2781 C  C     . GLU G 3 5  ? 61.913  46.289  171.245 1.00 38.40 ? 323  GLU C C     1 
ATOM   2782 O  O     . GLU G 3 5  ? 61.067  47.176  171.256 1.00 40.28 ? 323  GLU C O     1 
ATOM   2783 C  CB    . GLU G 3 5  ? 64.257  46.764  170.530 1.00 45.65 ? 323  GLU C CB    1 
ATOM   2784 C  CG    . GLU G 3 5  ? 65.605  47.364  170.860 1.00 48.44 ? 323  GLU C CG    1 
ATOM   2785 C  CD    . GLU G 3 5  ? 66.528  47.446  169.651 1.00 49.17 ? 323  GLU C CD    1 
ATOM   2786 O  OE1   . GLU G 3 5  ? 66.675  46.433  168.947 1.00 44.03 ? 323  GLU C OE1   1 
ATOM   2787 O  OE2   . GLU G 3 5  ? 67.115  48.521  169.410 1.00 50.77 ? 323  GLU C OE2   1 
ATOM   2788 N  N     . LYS G 3 6  ? 61.653  45.059  170.815 1.00 33.22 ? 324  LYS C N     1 
ATOM   2789 C  CA    . LYS G 3 6  ? 60.320  44.690  170.359 1.00 38.61 ? 324  LYS C CA    1 
ATOM   2790 C  C     . LYS G 3 6  ? 59.350  44.995  171.488 1.00 39.92 ? 324  LYS C C     1 
ATOM   2791 O  O     . LYS G 3 6  ? 58.321  45.640  171.280 1.00 37.42 ? 324  LYS C O     1 
ATOM   2792 C  CB    . LYS G 3 6  ? 60.234  43.201  170.055 1.00 40.68 ? 324  LYS C CB    1 
ATOM   2793 C  CG    . LYS G 3 6  ? 61.004  42.727  168.851 1.00 49.47 ? 324  LYS C CG    1 
ATOM   2794 C  CD    . LYS G 3 6  ? 60.750  41.231  168.653 1.00 60.79 ? 324  LYS C CD    1 
ATOM   2795 C  CE    . LYS G 3 6  ? 59.230  40.930  168.577 1.00 60.17 ? 324  LYS C CE    1 
ATOM   2796 N  NZ    . LYS G 3 6  ? 58.906  39.494  168.303 1.00 64.60 ? 324  LYS C NZ    1 
ATOM   2797 N  N     . ARG G 3 7  ? 59.711  44.511  172.679 1.00 39.45 ? 325  ARG C N     1 
ATOM   2798 C  CA    . ARG G 3 7  ? 58.953  44.686  173.917 1.00 37.39 ? 325  ARG C CA    1 
ATOM   2799 C  C     . ARG G 3 7  ? 58.635  46.170  174.139 1.00 32.93 ? 325  ARG C C     1 
ATOM   2800 O  O     . ARG G 3 7  ? 57.489  46.608  174.120 1.00 33.85 ? 325  ARG C O     1 
ATOM   2801 C  CB    . ARG G 3 7  ? 59.787  44.156  175.082 1.00 40.45 ? 325  ARG C CB    1 
ATOM   2802 C  CG    . ARG G 3 7  ? 58.993  43.576  176.237 1.00 48.48 ? 325  ARG C CG    1 
ATOM   2803 C  CD    . ARG G 3 7  ? 59.872  43.389  177.462 1.00 50.56 ? 325  ARG C CD    1 
ATOM   2804 N  NE    . ARG G 3 7  ? 60.675  44.586  177.673 1.00 61.16 ? 325  ARG C NE    1 
ATOM   2805 C  CZ    . ARG G 3 7  ? 62.006  44.589  177.705 1.00 67.01 ? 325  ARG C CZ    1 
ATOM   2806 N  NH1   . ARG G 3 7  ? 62.681  43.439  177.617 1.00 59.69 ? 325  ARG C NH1   1 
ATOM   2807 N  NH2   . ARG G 3 7  ? 62.660  45.740  177.872 1.00 63.03 ? 325  ARG C NH2   1 
ATOM   2808 N  N     . THR G 3 8  ? 59.660  46.968  174.289 1.00 24.14 ? 326  THR C N     1 
ATOM   2809 C  CA    . THR G 3 8  ? 59.433  48.366  174.475 1.00 25.27 ? 326  THR C CA    1 
ATOM   2810 C  C     . THR G 3 8  ? 58.575  49.013  173.386 1.00 28.48 ? 326  THR C C     1 
ATOM   2811 O  O     . THR G 3 8  ? 57.777  49.902  173.664 1.00 33.68 ? 326  THR C O     1 
ATOM   2812 C  CB    . THR G 3 8  ? 60.751  49.042  174.542 1.00 23.63 ? 326  THR C CB    1 
ATOM   2813 O  OG1   . THR G 3 8  ? 61.420  48.577  175.714 1.00 37.10 ? 326  THR C OG1   1 
ATOM   2814 C  CG2   . THR G 3 8  ? 60.593  50.539  174.582 1.00 30.85 ? 326  THR C CG2   1 
ATOM   2815 N  N     . ALA G 3 9  ? 58.763  48.595  172.142 1.00 28.64 ? 327  ALA C N     1 
ATOM   2816 C  CA    . ALA G 3 9  ? 58.008  49.160  171.033 1.00 27.46 ? 327  ALA C CA    1 
ATOM   2817 C  C     . ALA G 3 9  ? 56.574  48.727  171.163 1.00 29.75 ? 327  ALA C C     1 
ATOM   2818 O  O     . ALA G 3 9  ? 55.649  49.539  171.075 1.00 29.90 ? 327  ALA C O     1 
ATOM   2819 C  CB    . ALA G 3 9  ? 58.563  48.671  169.734 1.00 26.87 ? 327  ALA C CB    1 
ATOM   2820 N  N     . HIS G 3 10 ? 56.406  47.433  171.412 1.00 32.15 ? 328  HIS C N     1 
ATOM   2821 C  CA    . HIS G 3 10 ? 55.090  46.832  171.557 1.00 33.01 ? 328  HIS C CA    1 
ATOM   2822 C  C     . HIS G 3 10 ? 54.306  47.470  172.676 1.00 32.21 ? 328  HIS C C     1 
ATOM   2823 O  O     . HIS G 3 10 ? 53.087  47.554  172.603 1.00 37.95 ? 328  HIS C O     1 
ATOM   2824 C  CB    . HIS G 3 10 ? 55.182  45.339  171.818 1.00 29.02 ? 328  HIS C CB    1 
ATOM   2825 C  CG    . HIS G 3 10 ? 53.856  44.708  172.083 1.00 33.64 ? 328  HIS C CG    1 
ATOM   2826 N  ND1   . HIS G 3 10 ? 52.799  44.815  171.205 1.00 32.44 ? 328  HIS C ND1   1 
ATOM   2827 C  CD2   . HIS G 3 10 ? 53.405  43.974  173.130 1.00 35.62 ? 328  HIS C CD2   1 
ATOM   2828 C  CE1   . HIS G 3 10 ? 51.756  44.173  171.699 1.00 36.22 ? 328  HIS C CE1   1 
ATOM   2829 N  NE2   . HIS G 3 10 ? 52.099  43.653  172.864 1.00 34.73 ? 328  HIS C NE2   1 
ATOM   2830 N  N     . ASN G 3 11 ? 54.998  47.866  173.731 1.00 28.40 ? 329  ASN C N     1 
ATOM   2831 C  CA    . ASN G 3 11 ? 54.334  48.502  174.834 1.00 26.35 ? 329  ASN C CA    1 
ATOM   2832 C  C     . ASN G 3 11 ? 53.829  49.857  174.414 1.00 24.08 ? 329  ASN C C     1 
ATOM   2833 O  O     . ASN G 3 11 ? 52.760  50.267  174.830 1.00 30.44 ? 329  ASN C O     1 
ATOM   2834 C  CB    . ASN G 3 11 ? 55.258  48.621  176.032 1.00 22.34 ? 329  ASN C CB    1 
ATOM   2835 C  CG    . ASN G 3 11 ? 55.548  47.292  176.658 1.00 22.07 ? 329  ASN C CG    1 
ATOM   2836 O  OD1   . ASN G 3 11 ? 55.002  46.253  176.260 1.00 24.58 ? 329  ASN C OD1   1 
ATOM   2837 N  ND2   . ASN G 3 11 ? 56.446  47.300  177.624 1.00 30.64 ? 329  ASN C ND2   1 
ATOM   2838 N  N     . ALA G 3 12 ? 54.568  50.543  173.561 1.00 28.99 ? 330  ALA C N     1 
ATOM   2839 C  CA    . ALA G 3 12 ? 54.132  51.852  173.094 1.00 28.47 ? 330  ALA C CA    1 
ATOM   2840 C  C     . ALA G 3 12 ? 52.988  51.647  172.095 1.00 31.57 ? 330  ALA C C     1 
ATOM   2841 O  O     . ALA G 3 12 ? 52.062  52.456  172.003 1.00 34.98 ? 330  ALA C O     1 
ATOM   2842 C  CB    . ALA G 3 12 ? 55.275  52.582  172.460 1.00 24.12 ? 330  ALA C CB    1 
ATOM   2843 N  N     . ILE G 3 13 ? 53.041  50.541  171.367 1.00 30.34 ? 331  ILE C N     1 
ATOM   2844 C  CA    . ILE G 3 13 ? 52.000  50.207  170.408 1.00 27.12 ? 331  ILE C CA    1 
ATOM   2845 C  C     . ILE G 3 13 ? 50.712  49.967  171.201 1.00 29.18 ? 331  ILE C C     1 
ATOM   2846 O  O     . ILE G 3 13 ? 49.700  50.639  170.988 1.00 30.18 ? 331  ILE C O     1 
ATOM   2847 C  CB    . ILE G 3 13 ? 52.412  48.967  169.603 1.00 26.50 ? 331  ILE C CB    1 
ATOM   2848 C  CG1   . ILE G 3 13 ? 53.484  49.359  168.574 1.00 28.51 ? 331  ILE C CG1   1 
ATOM   2849 C  CG2   . ILE G 3 13 ? 51.226  48.334  168.922 1.00 23.72 ? 331  ILE C CG2   1 
ATOM   2850 C  CD1   . ILE G 3 13 ? 54.097  48.159  167.849 1.00 33.68 ? 331  ILE C CD1   1 
ATOM   2851 N  N     . GLU G 3 14 ? 50.796  49.076  172.179 1.00 27.60 ? 332  GLU C N     1 
ATOM   2852 C  CA    . GLU G 3 14 ? 49.680  48.748  173.048 1.00 28.36 ? 332  GLU C CA    1 
ATOM   2853 C  C     . GLU G 3 14 ? 49.118  49.983  173.810 1.00 31.06 ? 332  GLU C C     1 
ATOM   2854 O  O     . GLU G 3 14 ? 47.928  50.061  174.119 1.00 31.92 ? 332  GLU C O     1 
ATOM   2855 C  CB    . GLU G 3 14 ? 50.106  47.659  174.014 1.00 20.97 ? 332  GLU C CB    1 
ATOM   2856 C  CG    . GLU G 3 14 ? 48.996  47.186  174.940 1.00 38.47 ? 332  GLU C CG    1 
ATOM   2857 C  CD    . GLU G 3 14 ? 47.890  46.370  174.254 1.00 44.34 ? 332  GLU C CD    1 
ATOM   2858 O  OE1   . GLU G 3 14 ? 48.065  45.938  173.087 1.00 49.87 ? 332  GLU C OE1   1 
ATOM   2859 O  OE2   . GLU G 3 14 ? 46.835  46.147  174.900 1.00 49.57 ? 332  GLU C OE2   1 
ATOM   2860 N  N     . LYS G 3 15 ? 49.957  50.972  174.073 1.00 30.31 ? 333  LYS C N     1 
ATOM   2861 C  CA    . LYS G 3 15 ? 49.499  52.165  174.752 1.00 25.66 ? 333  LYS C CA    1 
ATOM   2862 C  C     . LYS G 3 15 ? 48.559  52.863  173.812 1.00 29.14 ? 333  LYS C C     1 
ATOM   2863 O  O     . LYS G 3 15 ? 47.516  53.345  174.228 1.00 37.21 ? 333  LYS C O     1 
ATOM   2864 C  CB    . LYS G 3 15 ? 50.673  53.080  175.066 1.00 28.63 ? 333  LYS C CB    1 
ATOM   2865 C  CG    . LYS G 3 15 ? 50.286  54.414  175.633 1.00 34.03 ? 333  LYS C CG    1 
ATOM   2866 C  CD    . LYS G 3 15 ? 51.490  55.317  175.743 1.00 38.97 ? 333  LYS C CD    1 
ATOM   2867 C  CE    . LYS G 3 15 ? 51.429  56.191  176.994 1.00 46.59 ? 333  LYS C CE    1 
ATOM   2868 N  NZ    . LYS G 3 15 ? 50.348  57.218  176.956 1.00 55.86 ? 333  LYS C NZ    1 
ATOM   2869 N  N     . ARG G 3 16 ? 48.961  52.947  172.545 1.00 33.62 ? 334  ARG C N     1 
ATOM   2870 C  CA    . ARG G 3 16 ? 48.171  53.577  171.492 1.00 30.91 ? 334  ARG C CA    1 
ATOM   2871 C  C     . ARG G 3 16 ? 46.893  52.766  171.294 1.00 30.09 ? 334  ARG C C     1 
ATOM   2872 O  O     . ARG G 3 16 ? 45.824  53.321  171.049 1.00 29.48 ? 334  ARG C O     1 
ATOM   2873 C  CB    . ARG G 3 16 ? 48.992  53.664  170.196 1.00 34.61 ? 334  ARG C CB    1 
ATOM   2874 C  CG    . ARG G 3 16 ? 48.169  53.633  168.882 1.00 48.32 ? 334  ARG C CG    1 
ATOM   2875 C  CD    . ARG G 3 16 ? 48.943  54.129  167.620 1.00 52.07 ? 334  ARG C CD    1 
ATOM   2876 N  NE    . ARG G 3 16 ? 50.148  53.344  167.372 1.00 55.80 ? 334  ARG C NE    1 
ATOM   2877 C  CZ    . ARG G 3 16 ? 51.354  53.654  167.846 1.00 55.27 ? 334  ARG C CZ    1 
ATOM   2878 N  NH1   . ARG G 3 16 ? 51.527  54.749  168.578 1.00 56.87 ? 334  ARG C NH1   1 
ATOM   2879 N  NH2   . ARG G 3 16 ? 52.369  52.815  167.683 1.00 52.63 ? 334  ARG C NH2   1 
ATOM   2880 N  N     . TYR G 3 17 ? 46.998  51.452  171.446 1.00 30.29 ? 335  TYR C N     1 
ATOM   2881 C  CA    . TYR G 3 17 ? 45.845  50.568  171.306 1.00 28.32 ? 335  TYR C CA    1 
ATOM   2882 C  C     . TYR G 3 17 ? 44.811  50.880  172.380 1.00 28.90 ? 335  TYR C C     1 
ATOM   2883 O  O     . TYR G 3 17 ? 43.634  50.981  172.092 1.00 35.05 ? 335  TYR C O     1 
ATOM   2884 C  CB    . TYR G 3 17 ? 46.269  49.106  171.423 1.00 31.23 ? 335  TYR C CB    1 
ATOM   2885 C  CG    . TYR G 3 17 ? 45.111  48.162  171.453 1.00 27.41 ? 335  TYR C CG    1 
ATOM   2886 C  CD1   . TYR G 3 17 ? 44.222  48.100  170.384 1.00 27.98 ? 335  TYR C CD1   1 
ATOM   2887 C  CD2   . TYR G 3 17 ? 44.871  47.368  172.560 1.00 25.71 ? 335  TYR C CD2   1 
ATOM   2888 C  CE1   . TYR G 3 17 ? 43.103  47.265  170.432 1.00 35.66 ? 335  TYR C CE1   1 
ATOM   2889 C  CE2   . TYR G 3 17 ? 43.769  46.528  172.619 1.00 28.03 ? 335  TYR C CE2   1 
ATOM   2890 C  CZ    . TYR G 3 17 ? 42.880  46.478  171.559 1.00 32.31 ? 335  TYR C CZ    1 
ATOM   2891 O  OH    . TYR G 3 17 ? 41.765  45.669  171.626 1.00 30.84 ? 335  TYR C OH    1 
ATOM   2892 N  N     . ARG G 3 18 ? 45.247  50.974  173.627 1.00 26.00 ? 336  ARG C N     1 
ATOM   2893 C  CA    . ARG G 3 18 ? 44.356  51.317  174.708 1.00 22.08 ? 336  ARG C CA    1 
ATOM   2894 C  C     . ARG G 3 18 ? 43.664  52.645  174.473 1.00 23.25 ? 336  ARG C C     1 
ATOM   2895 O  O     . ARG G 3 18 ? 42.456  52.724  174.615 1.00 30.02 ? 336  ARG C O     1 
ATOM   2896 C  CB    . ARG G 3 18 ? 45.107  51.363  176.033 1.00 26.25 ? 336  ARG C CB    1 
ATOM   2897 C  CG    . ARG G 3 18 ? 45.329  50.007  176.621 1.00 23.21 ? 336  ARG C CG    1 
ATOM   2898 C  CD    . ARG G 3 18 ? 46.012  50.130  177.928 1.00 28.42 ? 336  ARG C CD    1 
ATOM   2899 N  NE    . ARG G 3 18 ? 47.460  50.063  177.808 1.00 31.61 ? 336  ARG C NE    1 
ATOM   2900 C  CZ    . ARG G 3 18 ? 48.254  51.077  178.108 1.00 39.21 ? 336  ARG C CZ    1 
ATOM   2901 N  NH1   . ARG G 3 18 ? 47.721  52.219  178.531 1.00 41.43 ? 336  ARG C NH1   1 
ATOM   2902 N  NH2   . ARG G 3 18 ? 49.573  50.944  178.020 1.00 38.82 ? 336  ARG C NH2   1 
ATOM   2903 N  N     . SER G 3 19 ? 44.387  53.696  174.106 1.00 21.37 ? 337  SER C N     1 
ATOM   2904 C  CA    . SER G 3 19 ? 43.708  54.968  173.896 1.00 18.79 ? 337  SER C CA    1 
ATOM   2905 C  C     . SER G 3 19 ? 42.726  54.882  172.765 1.00 22.79 ? 337  SER C C     1 
ATOM   2906 O  O     . SER G 3 19 ? 41.699  55.531  172.808 1.00 30.85 ? 337  SER C O     1 
ATOM   2907 C  CB    . SER G 3 19 ? 44.682  56.083  173.580 1.00 18.34 ? 337  SER C CB    1 
ATOM   2908 O  OG    . SER G 3 19 ? 45.902  55.879  174.243 1.00 38.94 ? 337  SER C OG    1 
ATOM   2909 N  N     . SER G 3 20 ? 43.016  54.070  171.755 1.00 23.60 ? 338  SER C N     1 
ATOM   2910 C  CA    . SER G 3 20 ? 42.120  53.983  170.627 1.00 20.99 ? 338  SER C CA    1 
ATOM   2911 C  C     . SER G 3 20 ? 40.760  53.571  171.116 1.00 22.67 ? 338  SER C C     1 
ATOM   2912 O  O     . SER G 3 20 ? 39.750  53.980  170.563 1.00 29.71 ? 338  SER C O     1 
ATOM   2913 C  CB    . SER G 3 20 ? 42.631  52.999  169.602 1.00 17.31 ? 338  SER C CB    1 
ATOM   2914 O  OG    . SER G 3 20 ? 42.570  51.683  170.082 1.00 22.64 ? 338  SER C OG    1 
ATOM   2915 N  N     . ILE G 3 21 ? 40.733  52.784  172.182 1.00 26.45 ? 339  ILE C N     1 
ATOM   2916 C  CA    . ILE G 3 21 ? 39.483  52.323  172.766 1.00 23.54 ? 339  ILE C CA    1 
ATOM   2917 C  C     . ILE G 3 21 ? 38.992  53.250  173.894 1.00 24.34 ? 339  ILE C C     1 
ATOM   2918 O  O     . ILE G 3 21 ? 37.884  53.795  173.831 1.00 26.30 ? 339  ILE C O     1 
ATOM   2919 C  CB    . ILE G 3 21 ? 39.628  50.880  173.287 1.00 20.85 ? 339  ILE C CB    1 
ATOM   2920 C  CG1   . ILE G 3 21 ? 39.825  49.927  172.120 1.00 16.86 ? 339  ILE C CG1   1 
ATOM   2921 C  CG2   . ILE G 3 21 ? 38.409  50.462  174.071 1.00 26.09 ? 339  ILE C CG2   1 
ATOM   2922 C  CD1   . ILE G 3 21 ? 39.899  48.464  172.536 1.00 20.81 ? 339  ILE C CD1   1 
ATOM   2923 N  N     . ASN G 3 22 ? 39.847  53.513  174.872 1.00 23.16 ? 340  ASN C N     1 
ATOM   2924 C  CA    . ASN G 3 22 ? 39.445  54.321  176.011 1.00 20.55 ? 340  ASN C CA    1 
ATOM   2925 C  C     . ASN G 3 22 ? 39.015  55.696  175.633 1.00 22.88 ? 340  ASN C C     1 
ATOM   2926 O  O     . ASN G 3 22 ? 38.099  56.237  176.229 1.00 25.91 ? 340  ASN C O     1 
ATOM   2927 C  CB    . ASN G 3 22 ? 40.535  54.379  177.068 1.00 19.62 ? 340  ASN C CB    1 
ATOM   2928 C  CG    . ASN G 3 22 ? 40.781  53.040  177.731 1.00 24.74 ? 340  ASN C CG    1 
ATOM   2929 O  OD1   . ASN G 3 22 ? 39.857  52.240  177.925 1.00 24.69 ? 340  ASN C OD1   1 
ATOM   2930 N  ND2   . ASN G 3 22 ? 42.033  52.787  178.091 1.00 22.07 ? 340  ASN C ND2   1 
ATOM   2931 N  N     . ASP G 3 23 ? 39.595  56.227  174.572 1.00 24.14 ? 341  ASP C N     1 
ATOM   2932 C  CA    . ASP G 3 23 ? 39.261  57.567  174.143 1.00 23.30 ? 341  ASP C CA    1 
ATOM   2933 C  C     . ASP G 3 23 ? 37.889  57.637  173.538 1.00 29.15 ? 341  ASP C C     1 
ATOM   2934 O  O     . ASP G 3 23 ? 37.219  58.671  173.596 1.00 32.77 ? 341  ASP C O     1 
ATOM   2935 C  CB    . ASP G 3 23 ? 40.301  58.073  173.170 1.00 32.00 ? 341  ASP C CB    1 
ATOM   2936 C  CG    . ASP G 3 23 ? 41.660  58.245  173.818 1.00 41.11 ? 341  ASP C CG    1 
ATOM   2937 O  OD1   . ASP G 3 23 ? 41.789  58.044  175.052 1.00 49.00 ? 341  ASP C OD1   1 
ATOM   2938 O  OD2   . ASP G 3 23 ? 42.616  58.587  173.089 1.00 59.98 ? 341  ASP C OD2   1 
ATOM   2939 N  N     . LYS G 3 24 ? 37.470  56.530  172.945 1.00 29.28 ? 342  LYS C N     1 
ATOM   2940 C  CA    . LYS G 3 24 ? 36.163  56.463  172.345 1.00 27.75 ? 342  LYS C CA    1 
ATOM   2941 C  C     . LYS G 3 24 ? 35.131  56.211  173.429 1.00 30.18 ? 342  LYS C C     1 
ATOM   2942 O  O     . LYS G 3 24 ? 34.016  56.716  173.351 1.00 39.38 ? 342  LYS C O     1 
ATOM   2943 C  CB    . LYS G 3 24 ? 36.148  55.413  171.251 1.00 30.59 ? 342  LYS C CB    1 
ATOM   2944 C  CG    . LYS G 3 24 ? 36.985  55.865  170.047 1.00 28.75 ? 342  LYS C CG    1 
ATOM   2945 C  CD    . LYS G 3 24 ? 37.019  54.841  168.919 1.00 30.40 ? 342  LYS C CD    1 
ATOM   2946 C  CE    . LYS G 3 24 ? 37.833  55.339  167.760 1.00 27.86 ? 342  LYS C CE    1 
ATOM   2947 N  NZ    . LYS G 3 24 ? 39.254  55.357  168.158 1.00 33.86 ? 342  LYS C NZ    1 
ATOM   2948 N  N     . ILE G 3 25 ? 35.494  55.480  174.474 1.00 31.71 ? 343  ILE C N     1 
ATOM   2949 C  CA    . ILE G 3 25 ? 34.558  55.271  175.583 1.00 28.45 ? 343  ILE C CA    1 
ATOM   2950 C  C     . ILE G 3 25 ? 34.254  56.626  176.282 1.00 28.36 ? 343  ILE C C     1 
ATOM   2951 O  O     . ILE G 3 25 ? 33.113  56.921  176.659 1.00 28.13 ? 343  ILE C O     1 
ATOM   2952 C  CB    . ILE G 3 25 ? 35.085  54.191  176.559 1.00 27.58 ? 343  ILE C CB    1 
ATOM   2953 C  CG1   . ILE G 3 25 ? 34.974  52.823  175.877 1.00 21.95 ? 343  ILE C CG1   1 
ATOM   2954 C  CG2   . ILE G 3 25 ? 34.275  54.171  177.848 1.00 25.18 ? 343  ILE C CG2   1 
ATOM   2955 C  CD1   . ILE G 3 25 ? 35.618  51.681  176.629 1.00 20.25 ? 343  ILE C CD1   1 
ATOM   2956 N  N     . ILE G 3 26 ? 35.261  57.484  176.381 1.00 28.79 ? 344  ILE C N     1 
ATOM   2957 C  CA    . ILE G 3 26 ? 35.082  58.800  176.987 1.00 26.45 ? 344  ILE C CA    1 
ATOM   2958 C  C     . ILE G 3 26 ? 34.162  59.606  176.091 1.00 26.91 ? 344  ILE C C     1 
ATOM   2959 O  O     . ILE G 3 26 ? 33.290  60.307  176.572 1.00 31.03 ? 344  ILE C O     1 
ATOM   2960 C  CB    . ILE G 3 26 ? 36.423  59.535  177.122 1.00 25.24 ? 344  ILE C CB    1 
ATOM   2961 C  CG1   . ILE G 3 26 ? 37.257  58.892  178.207 1.00 20.18 ? 344  ILE C CG1   1 
ATOM   2962 C  CG2   . ILE G 3 26 ? 36.221  60.994  177.413 1.00 19.29 ? 344  ILE C CG2   1 
ATOM   2963 C  CD1   . ILE G 3 26 ? 38.676  59.387  178.190 1.00 28.25 ? 344  ILE C CD1   1 
ATOM   2964 N  N     . GLU G 3 27 ? 34.401  59.549  174.786 1.00 29.88 ? 345  GLU C N     1 
ATOM   2965 C  CA    . GLU G 3 27 ? 33.560  60.253  173.828 1.00 29.90 ? 345  GLU C CA    1 
ATOM   2966 C  C     . GLU G 3 27 ? 32.116  59.810  174.043 1.00 29.13 ? 345  GLU C C     1 
ATOM   2967 O  O     . GLU G 3 27 ? 31.221  60.655  174.149 1.00 33.54 ? 345  GLU C O     1 
ATOM   2968 C  CB    . GLU G 3 27 ? 33.999  59.957  172.387 1.00 35.66 ? 345  GLU C CB    1 
ATOM   2969 C  CG    . GLU G 3 27 ? 34.677  61.127  171.669 1.00 41.69 ? 345  GLU C CG    1 
ATOM   2970 C  CD    . GLU G 3 27 ? 35.263  60.768  170.285 1.00 44.47 ? 345  GLU C CD    1 
ATOM   2971 O  OE1   . GLU G 3 27 ? 36.167  59.900  170.203 1.00 38.34 ? 345  GLU C OE1   1 
ATOM   2972 O  OE2   . GLU G 3 27 ? 34.837  61.385  169.278 1.00 45.48 ? 345  GLU C OE2   1 
ATOM   2973 N  N     . LEU G 3 28 ? 31.890  58.498  174.143 1.00 28.40 ? 346  LEU C N     1 
ATOM   2974 C  CA    . LEU G 3 28 ? 30.545  57.971  174.373 1.00 28.05 ? 346  LEU C CA    1 
ATOM   2975 C  C     . LEU G 3 28 ? 30.006  58.407  175.722 1.00 30.87 ? 346  LEU C C     1 
ATOM   2976 O  O     . LEU G 3 28 ? 28.793  58.602  175.879 1.00 30.61 ? 346  LEU C O     1 
ATOM   2977 C  CB    . LEU G 3 28 ? 30.533  56.457  174.322 1.00 21.00 ? 346  LEU C CB    1 
ATOM   2978 C  CG    . LEU G 3 28 ? 30.682  55.983  172.899 1.00 21.82 ? 346  LEU C CG    1 
ATOM   2979 C  CD1   . LEU G 3 28 ? 30.840  54.452  172.872 1.00 19.34 ? 346  LEU C CD1   1 
ATOM   2980 C  CD2   . LEU G 3 28 ? 29.464  56.468  172.147 1.00 14.94 ? 346  LEU C CD2   1 
ATOM   2981 N  N     . LYS G 3 29 ? 30.899  58.516  176.706 1.00 31.12 ? 347  LYS C N     1 
ATOM   2982 C  CA    . LYS G 3 29 ? 30.498  58.948  178.036 1.00 31.09 ? 347  LYS C CA    1 
ATOM   2983 C  C     . LYS G 3 29 ? 29.960  60.369  177.975 1.00 27.49 ? 347  LYS C C     1 
ATOM   2984 O  O     . LYS G 3 29 ? 28.903  60.678  178.509 1.00 29.17 ? 347  LYS C O     1 
ATOM   2985 C  CB    . LYS G 3 29 ? 31.670  58.884  179.005 1.00 34.24 ? 347  LYS C CB    1 
ATOM   2986 C  CG    . LYS G 3 29 ? 31.254  59.055  180.451 1.00 26.48 ? 347  LYS C CG    1 
ATOM   2987 C  CD    . LYS G 3 29 ? 32.063  60.152  181.102 1.00 34.09 ? 347  LYS C CD    1 
ATOM   2988 C  CE    . LYS G 3 29 ? 31.482  61.490  180.775 1.00 35.81 ? 347  LYS C CE    1 
ATOM   2989 N  NZ    . LYS G 3 29 ? 32.358  62.600  181.225 1.00 37.78 ? 347  LYS C NZ    1 
ATOM   2990 N  N     . ASP G 3 30 ? 30.666  61.223  177.268 1.00 27.36 ? 348  ASP C N     1 
ATOM   2991 C  CA    . ASP G 3 30 ? 30.232  62.588  177.157 1.00 28.86 ? 348  ASP C CA    1 
ATOM   2992 C  C     . ASP G 3 30 ? 28.895  62.662  176.451 1.00 28.18 ? 348  ASP C C     1 
ATOM   2993 O  O     . ASP G 3 30 ? 28.048  63.459  176.821 1.00 34.39 ? 348  ASP C O     1 
ATOM   2994 C  CB    . ASP G 3 30 ? 31.286  63.422  176.446 1.00 31.38 ? 348  ASP C CB    1 
ATOM   2995 C  CG    . ASP G 3 30 ? 32.590  63.530  177.243 1.00 37.75 ? 348  ASP C CG    1 
ATOM   2996 O  OD1   . ASP G 3 30 ? 32.640  63.174  178.437 1.00 46.30 ? 348  ASP C OD1   1 
ATOM   2997 O  OD2   . ASP G 3 30 ? 33.588  64.004  176.679 1.00 47.86 ? 348  ASP C OD2   1 
ATOM   2998 N  N     . LEU G 3 31 ? 28.658  61.777  175.495 1.00 31.03 ? 349  LEU C N     1 
ATOM   2999 C  CA    . LEU G 3 31 ? 27.398  61.794  174.749 1.00 24.28 ? 349  LEU C CA    1 
ATOM   3000 C  C     . LEU G 3 31 ? 26.202  61.304  175.542 1.00 26.06 ? 349  LEU C C     1 
ATOM   3001 O  O     . LEU G 3 31 ? 25.090  61.771  175.342 1.00 32.28 ? 349  LEU C O     1 
ATOM   3002 C  CB    . LEU G 3 31 ? 27.522  60.977  173.464 1.00 22.52 ? 349  LEU C CB    1 
ATOM   3003 C  CG    . LEU G 3 31 ? 28.266  61.572  172.262 1.00 21.65 ? 349  LEU C CG    1 
ATOM   3004 C  CD1   . LEU G 3 31 ? 28.588  60.481  171.228 1.00 15.47 ? 349  LEU C CD1   1 
ATOM   3005 C  CD2   . LEU G 3 31 ? 27.379  62.642  171.638 1.00 24.89 ? 349  LEU C CD2   1 
ATOM   3006 N  N     . VAL G 3 32 ? 26.430  60.380  176.460 1.00 30.57 ? 350  VAL C N     1 
ATOM   3007 C  CA    . VAL G 3 32 ? 25.345  59.818  177.251 1.00 32.44 ? 350  VAL C CA    1 
ATOM   3008 C  C     . VAL G 3 32 ? 25.134  60.367  178.664 1.00 32.14 ? 350  VAL C C     1 
ATOM   3009 O  O     . VAL G 3 32 ? 24.029  60.235  179.198 1.00 29.30 ? 350  VAL C O     1 
ATOM   3010 C  CB    . VAL G 3 32 ? 25.460  58.301  177.330 1.00 25.80 ? 350  VAL C CB    1 
ATOM   3011 C  CG1   . VAL G 3 32 ? 25.363  57.723  175.946 1.00 28.42 ? 350  VAL C CG1   1 
ATOM   3012 C  CG2   . VAL G 3 32 ? 26.750  57.911  178.018 1.00 24.99 ? 350  VAL C CG2   1 
ATOM   3013 N  N     . VAL G 3 33 ? 26.193  60.852  179.313 1.00 28.75 ? 351  VAL C N     1 
ATOM   3014 C  CA    . VAL G 3 33 ? 26.056  61.428  180.650 1.00 27.75 ? 351  VAL C CA    1 
ATOM   3015 C  C     . VAL G 3 33 ? 26.764  62.765  180.693 1.00 32.41 ? 351  VAL C C     1 
ATOM   3016 O  O     . VAL G 3 33 ? 26.896  63.388  181.758 1.00 42.47 ? 351  VAL C O     1 
ATOM   3017 C  CB    . VAL G 3 33 ? 26.577  60.526  181.838 1.00 24.64 ? 351  VAL C CB    1 
ATOM   3018 C  CG1   . VAL G 3 33 ? 25.792  59.229  181.956 1.00 24.51 ? 351  VAL C CG1   1 
ATOM   3019 C  CG2   . VAL G 3 33 ? 28.043  60.264  181.732 1.00 30.27 ? 351  VAL C CG2   1 
ATOM   3020 N  N     . GLY G 3 34 ? 27.246  63.214  179.546 1.00 29.27 ? 352  GLY C N     1 
ATOM   3021 C  CA    . GLY G 3 34 ? 27.894  64.506  179.533 1.00 30.81 ? 352  GLY C CA    1 
ATOM   3022 C  C     . GLY G 3 34 ? 29.333  64.567  179.990 1.00 35.91 ? 352  GLY C C     1 
ATOM   3023 O  O     . GLY G 3 34 ? 29.814  63.744  180.762 1.00 26.61 ? 352  GLY C O     1 
ATOM   3024 N  N     . THR G 3 35 ? 29.983  65.632  179.525 1.00 43.49 ? 353  THR C N     1 
ATOM   3025 C  CA    . THR G 3 35 ? 31.387  65.922  179.773 1.00 47.14 ? 353  THR C CA    1 
ATOM   3026 C  C     . THR G 3 35 ? 31.767  65.993  181.241 1.00 48.77 ? 353  THR C C     1 
ATOM   3027 O  O     . THR G 3 35 ? 32.864  65.582  181.620 1.00 52.63 ? 353  THR C O     1 
ATOM   3028 C  CB    . THR G 3 35 ? 31.790  67.221  179.045 1.00 39.39 ? 353  THR C CB    1 
ATOM   3029 N  N     . GLU G 3 36 ? 30.853  66.474  182.076 1.00 53.61 ? 354  GLU C N     1 
ATOM   3030 C  CA    . GLU G 3 36 ? 31.148  66.617  183.502 1.00 53.10 ? 354  GLU C CA    1 
ATOM   3031 C  C     . GLU G 3 36 ? 31.007  65.343  184.338 1.00 49.61 ? 354  GLU C C     1 
ATOM   3032 O  O     . GLU G 3 36 ? 31.797  65.114  185.247 1.00 52.16 ? 354  GLU C O     1 
ATOM   3033 C  CB    . GLU G 3 36 ? 30.326  67.768  184.100 1.00 51.74 ? 354  GLU C CB    1 
ATOM   3034 N  N     . ALA G 3 37 ? 30.038  64.498  184.005 1.00 48.22 ? 355  ALA C N     1 
ATOM   3035 C  CA    . ALA G 3 37 ? 29.808  63.264  184.752 1.00 44.75 ? 355  ALA C CA    1 
ATOM   3036 C  C     . ALA G 3 37 ? 30.972  62.299  184.722 1.00 44.14 ? 355  ALA C C     1 
ATOM   3037 O  O     . ALA G 3 37 ? 31.881  62.429  183.913 1.00 47.89 ? 355  ALA C O     1 
ATOM   3038 C  CB    . ALA G 3 37 ? 28.592  62.571  184.221 1.00 41.16 ? 355  ALA C CB    1 
ATOM   3039 N  N     . LYS G 3 38 ? 30.920  61.314  185.608 1.00 43.28 ? 356  LYS C N     1 
ATOM   3040 C  CA    . LYS G 3 38 ? 31.938  60.272  185.681 1.00 43.13 ? 356  LYS C CA    1 
ATOM   3041 C  C     . LYS G 3 38 ? 31.133  58.978  185.700 1.00 42.51 ? 356  LYS C C     1 
ATOM   3042 O  O     . LYS G 3 38 ? 30.173  58.851  186.465 1.00 45.33 ? 356  LYS C O     1 
ATOM   3043 C  CB    . LYS G 3 38 ? 32.792  60.406  186.964 1.00 43.89 ? 356  LYS C CB    1 
ATOM   3044 N  N     . LEU G 3 39 ? 31.485  58.036  184.836 1.00 35.28 ? 357  LEU C N     1 
ATOM   3045 C  CA    . LEU G 3 39 ? 30.745  56.785  184.768 1.00 31.28 ? 357  LEU C CA    1 
ATOM   3046 C  C     . LEU G 3 39 ? 31.727  55.732  184.312 1.00 30.12 ? 357  LEU C C     1 
ATOM   3047 O  O     . LEU G 3 39 ? 32.690  56.045  183.607 1.00 32.61 ? 357  LEU C O     1 
ATOM   3048 C  CB    . LEU G 3 39 ? 29.573  56.941  183.802 1.00 25.72 ? 357  LEU C CB    1 
ATOM   3049 C  CG    . LEU G 3 39 ? 28.706  55.766  183.404 1.00 24.04 ? 357  LEU C CG    1 
ATOM   3050 C  CD1   . LEU G 3 39 ? 28.043  55.133  184.561 1.00 22.65 ? 357  LEU C CD1   1 
ATOM   3051 C  CD2   . LEU G 3 39 ? 27.677  56.312  182.453 1.00 30.13 ? 357  LEU C CD2   1 
ATOM   3052 N  N     . ASN G 3 40 ? 31.533  54.504  184.778 1.00 28.27 ? 358  ASN C N     1 
ATOM   3053 C  CA    . ASN G 3 40 ? 32.445  53.431  184.450 1.00 27.29 ? 358  ASN C CA    1 
ATOM   3054 C  C     . ASN G 3 40 ? 32.201  52.900  183.057 1.00 30.09 ? 358  ASN C C     1 
ATOM   3055 O  O     . ASN G 3 40 ? 31.077  52.938  182.564 1.00 32.84 ? 358  ASN C O     1 
ATOM   3056 C  CB    . ASN G 3 40 ? 32.367  52.326  185.490 1.00 24.72 ? 358  ASN C CB    1 
ATOM   3057 C  CG    . ASN G 3 40 ? 31.029  51.687  185.541 1.00 29.38 ? 358  ASN C CG    1 
ATOM   3058 O  OD1   . ASN G 3 40 ? 30.872  50.531  185.152 1.00 31.98 ? 358  ASN C OD1   1 
ATOM   3059 N  ND2   . ASN G 3 40 ? 30.037  52.425  186.016 1.00 31.00 ? 358  ASN C ND2   1 
ATOM   3060 N  N     . LYS G 3 41 ? 33.242  52.315  182.476 1.00 32.01 ? 359  LYS C N     1 
ATOM   3061 C  CA    . LYS G 3 41 ? 33.206  51.817  181.109 1.00 25.06 ? 359  LYS C CA    1 
ATOM   3062 C  C     . LYS G 3 41 ? 32.031  50.958  180.674 1.00 26.62 ? 359  LYS C C     1 
ATOM   3063 O  O     . LYS G 3 41 ? 31.402  51.274  179.671 1.00 28.44 ? 359  LYS C O     1 
ATOM   3064 C  CB    . LYS G 3 41 ? 34.538  51.145  180.728 1.00 28.24 ? 359  LYS C CB    1 
ATOM   3065 C  CG    . LYS G 3 41 ? 35.766  52.062  180.762 1.00 17.93 ? 359  LYS C CG    1 
ATOM   3066 C  CD    . LYS G 3 41 ? 37.036  51.252  180.538 1.00 20.77 ? 359  LYS C CD    1 
ATOM   3067 C  CE    . LYS G 3 41 ? 38.302  52.078  180.696 1.00 18.15 ? 359  LYS C CE    1 
ATOM   3068 N  NZ    . LYS G 3 41 ? 39.515  51.249  180.405 1.00 18.61 ? 359  LYS C NZ    1 
ATOM   3069 N  N     . SER G 3 42 ? 31.707  49.891  181.393 1.00 24.58 ? 360  SER C N     1 
ATOM   3070 C  CA    . SER G 3 42 ? 30.599  49.061  180.941 1.00 24.34 ? 360  SER C CA    1 
ATOM   3071 C  C     . SER G 3 42 ? 29.257  49.762  181.019 1.00 28.12 ? 360  SER C C     1 
ATOM   3072 O  O     . SER G 3 42 ? 28.376  49.514  180.194 1.00 29.09 ? 360  SER C O     1 
ATOM   3073 C  CB    . SER G 3 42 ? 30.554  47.740  181.689 1.00 28.65 ? 360  SER C CB    1 
ATOM   3074 O  OG    . SER G 3 42 ? 30.740  47.914  183.080 1.00 28.73 ? 360  SER C OG    1 
ATOM   3075 N  N     . ALA G 3 43 ? 29.115  50.658  181.994 1.00 27.02 ? 361  ALA C N     1 
ATOM   3076 C  CA    . ALA G 3 43 ? 27.881  51.408  182.199 1.00 20.67 ? 361  ALA C CA    1 
ATOM   3077 C  C     . ALA G 3 43 ? 27.677  52.432  181.081 1.00 22.96 ? 361  ALA C C     1 
ATOM   3078 O  O     . ALA G 3 43 ? 26.557  52.663  180.641 1.00 23.22 ? 361  ALA C O     1 
ATOM   3079 C  CB    . ALA G 3 43 ? 27.918  52.080  183.533 1.00 19.46 ? 361  ALA C CB    1 
ATOM   3080 N  N     . VAL G 3 44 ? 28.770  53.058  180.656 1.00 23.69 ? 362  VAL C N     1 
ATOM   3081 C  CA    . VAL G 3 44 ? 28.779  54.022  179.570 1.00 18.58 ? 362  VAL C CA    1 
ATOM   3082 C  C     . VAL G 3 44 ? 28.381  53.278  178.292 1.00 21.96 ? 362  VAL C C     1 
ATOM   3083 O  O     . VAL G 3 44 ? 27.533  53.748  177.521 1.00 25.20 ? 362  VAL C O     1 
ATOM   3084 C  CB    . VAL G 3 44 ? 30.187  54.609  179.383 1.00 22.58 ? 362  VAL C CB    1 
ATOM   3085 C  CG1   . VAL G 3 44 ? 30.401  55.050  177.961 1.00 21.88 ? 362  VAL C CG1   1 
ATOM   3086 C  CG2   . VAL G 3 44 ? 30.382  55.771  180.294 1.00 17.18 ? 362  VAL C CG2   1 
ATOM   3087 N  N     . LEU G 3 45 ? 28.976  52.111  178.066 1.00 18.74 ? 363  LEU C N     1 
ATOM   3088 C  CA    . LEU G 3 45 ? 28.617  51.358  176.888 1.00 16.50 ? 363  LEU C CA    1 
ATOM   3089 C  C     . LEU G 3 45 ? 27.192  50.916  176.974 1.00 19.26 ? 363  LEU C C     1 
ATOM   3090 O  O     . LEU G 3 45 ? 26.536  50.853  175.946 1.00 31.10 ? 363  LEU C O     1 
ATOM   3091 C  CB    . LEU G 3 45 ? 29.519  50.155  176.642 1.00 18.22 ? 363  LEU C CB    1 
ATOM   3092 C  CG    . LEU G 3 45 ? 30.998  50.521  176.559 1.00 19.51 ? 363  LEU C CG    1 
ATOM   3093 C  CD1   . LEU G 3 45 ? 31.764  49.251  176.438 1.00 16.31 ? 363  LEU C CD1   1 
ATOM   3094 C  CD2   . LEU G 3 45 ? 31.280  51.478  175.400 1.00 20.71 ? 363  LEU C CD2   1 
ATOM   3095 N  N     . ARG G 3 46 ? 26.679  50.637  178.172 1.00 23.92 ? 364  ARG C N     1 
ATOM   3096 C  CA    . ARG G 3 46 ? 25.289  50.205  178.297 1.00 16.03 ? 364  ARG C CA    1 
ATOM   3097 C  C     . ARG G 3 46 ? 24.363  51.342  177.979 1.00 22.16 ? 364  ARG C C     1 
ATOM   3098 O  O     . ARG G 3 46 ? 23.349  51.150  177.334 1.00 25.53 ? 364  ARG C O     1 
ATOM   3099 C  CB    . ARG G 3 46 ? 25.001  49.690  179.682 1.00 22.96 ? 364  ARG C CB    1 
ATOM   3100 C  CG    . ARG G 3 46 ? 23.541  49.464  179.976 1.00 27.51 ? 364  ARG C CG    1 
ATOM   3101 C  CD    . ARG G 3 46 ? 23.041  48.157  179.437 1.00 38.36 ? 364  ARG C CD    1 
ATOM   3102 N  NE    . ARG G 3 46 ? 22.573  48.236  178.057 1.00 47.59 ? 364  ARG C NE    1 
ATOM   3103 C  CZ    . ARG G 3 46 ? 22.651  47.226  177.197 1.00 49.64 ? 364  ARG C CZ    1 
ATOM   3104 N  NH1   . ARG G 3 46 ? 23.193  46.078  177.575 1.00 48.29 ? 364  ARG C NH1   1 
ATOM   3105 N  NH2   . ARG G 3 46 ? 22.145  47.345  175.978 1.00 59.36 ? 364  ARG C NH2   1 
ATOM   3106 N  N     . LYS G 3 47 ? 24.710  52.536  178.436 1.00 23.69 ? 365  LYS C N     1 
ATOM   3107 C  CA    . LYS G 3 47 ? 23.902  53.712  178.158 1.00 23.41 ? 365  LYS C CA    1 
ATOM   3108 C  C     . LYS G 3 47 ? 23.986  54.052  176.675 1.00 26.07 ? 365  LYS C C     1 
ATOM   3109 O  O     . LYS G 3 47 ? 23.001  54.479  176.096 1.00 32.72 ? 365  LYS C O     1 
ATOM   3110 C  CB    . LYS G 3 47 ? 24.372  54.920  178.970 1.00 23.01 ? 365  LYS C CB    1 
ATOM   3111 C  CG    . LYS G 3 47 ? 24.062  54.846  180.428 1.00 22.19 ? 365  LYS C CG    1 
ATOM   3112 C  CD    . LYS G 3 47 ? 24.469  56.130  181.152 1.00 24.10 ? 365  LYS C CD    1 
ATOM   3113 C  CE    . LYS G 3 47 ? 24.006  56.113  182.599 1.00 27.59 ? 365  LYS C CE    1 
ATOM   3114 N  NZ    . LYS G 3 47 ? 22.522  55.866  182.779 1.00 30.29 ? 365  LYS C NZ    1 
ATOM   3115 N  N     . ALA G 3 48 ? 25.164  53.924  176.066 1.00 26.65 ? 366  ALA C N     1 
ATOM   3116 C  CA    . ALA G 3 48 ? 25.303  54.208  174.641 1.00 21.19 ? 366  ALA C CA    1 
ATOM   3117 C  C     . ALA G 3 48 ? 24.411  53.289  173.795 1.00 18.01 ? 366  ALA C C     1 
ATOM   3118 O  O     . ALA G 3 48 ? 23.816  53.722  172.831 1.00 22.75 ? 366  ALA C O     1 
ATOM   3119 C  CB    . ALA G 3 48 ? 26.735  54.075  174.219 1.00 15.28 ? 366  ALA C CB    1 
ATOM   3120 N  N     . ILE G 3 49 ? 24.285  52.031  174.173 1.00 15.79 ? 367  ILE C N     1 
ATOM   3121 C  CA    . ILE G 3 49 ? 23.466  51.097  173.418 1.00 15.57 ? 367  ILE C CA    1 
ATOM   3122 C  C     . ILE G 3 49 ? 21.999  51.494  173.476 1.00 21.90 ? 367  ILE C C     1 
ATOM   3123 O  O     . ILE G 3 49 ? 21.307  51.471  172.468 1.00 28.54 ? 367  ILE C O     1 
ATOM   3124 C  CB    . ILE G 3 49 ? 23.623  49.661  173.978 1.00 18.02 ? 367  ILE C CB    1 
ATOM   3125 C  CG1   . ILE G 3 49 ? 25.042  49.143  173.751 1.00 12.06 ? 367  ILE C CG1   1 
ATOM   3126 C  CG2   . ILE G 3 49 ? 22.614  48.715  173.371 1.00 18.85 ? 367  ILE C CG2   1 
ATOM   3127 C  CD1   . ILE G 3 49 ? 25.355  47.940  174.625 1.00 13.10 ? 367  ILE C CD1   1 
ATOM   3128 N  N     . ASP G 3 50 ? 21.517  51.863  174.657 1.00 24.50 ? 368  ASP C N     1 
ATOM   3129 C  CA    . ASP G 3 50 ? 20.116  52.245  174.826 1.00 23.00 ? 368  ASP C CA    1 
ATOM   3130 C  C     . ASP G 3 50 ? 19.789  53.624  174.312 1.00 16.93 ? 368  ASP C C     1 
ATOM   3131 O  O     . ASP G 3 50 ? 18.646  53.917  174.023 1.00 24.77 ? 368  ASP C O     1 
ATOM   3132 C  CB    . ASP G 3 50 ? 19.703  52.134  176.290 1.00 35.49 ? 368  ASP C CB    1 
ATOM   3133 C  CG    . ASP G 3 50 ? 20.002  50.777  176.882 1.00 41.06 ? 368  ASP C CG    1 
ATOM   3134 O  OD1   . ASP G 3 50 ? 19.983  49.773  176.130 1.00 45.71 ? 368  ASP C OD1   1 
ATOM   3135 O  OD2   . ASP G 3 50 ? 20.262  50.725  178.107 1.00 50.31 ? 368  ASP C OD2   1 
ATOM   3136 N  N     . TYR G 3 51 ? 20.763  54.508  174.341 1.00 13.22 ? 369  TYR C N     1 
ATOM   3137 C  CA    . TYR G 3 51 ? 20.612  55.846  173.816 1.00 12.42 ? 369  TYR C CA    1 
ATOM   3138 C  C     . TYR G 3 51 ? 20.480  55.698  172.292 1.00 16.51 ? 369  TYR C C     1 
ATOM   3139 O  O     . TYR G 3 51 ? 19.596  56.277  171.701 1.00 26.50 ? 369  TYR C O     1 
ATOM   3140 C  CB    . TYR G 3 51 ? 21.853  56.669  174.128 1.00 16.00 ? 369  TYR C CB    1 
ATOM   3141 C  CG    . TYR G 3 51 ? 21.717  58.133  173.795 1.00 16.75 ? 369  TYR C CG    1 
ATOM   3142 C  CD1   . TYR G 3 51 ? 20.469  58.761  173.830 1.00 12.38 ? 369  TYR C CD1   1 
ATOM   3143 C  CD2   . TYR G 3 51 ? 22.842  58.895  173.423 1.00 14.62 ? 369  TYR C CD2   1 
ATOM   3144 C  CE1   . TYR G 3 51 ? 20.330  60.101  173.497 1.00 19.16 ? 369  TYR C CE1   1 
ATOM   3145 C  CE2   . TYR G 3 51 ? 22.714  60.254  173.095 1.00 17.37 ? 369  TYR C CE2   1 
ATOM   3146 C  CZ    . TYR G 3 51 ? 21.450  60.837  173.129 1.00 20.98 ? 369  TYR C CZ    1 
ATOM   3147 O  OH    . TYR G 3 51 ? 21.293  62.148  172.770 1.00 25.75 ? 369  TYR C OH    1 
ATOM   3148 N  N     . ILE G 3 52 ? 21.344  54.916  171.652 1.00 19.26 ? 370  ILE C N     1 
ATOM   3149 C  CA    . ILE G 3 52 ? 21.252  54.696  170.205 1.00 18.66 ? 370  ILE C CA    1 
ATOM   3150 C  C     . ILE G 3 52 ? 19.852  54.210  169.832 1.00 17.91 ? 370  ILE C C     1 
ATOM   3151 O  O     . ILE G 3 52 ? 19.224  54.797  168.940 1.00 31.85 ? 370  ILE C O     1 
ATOM   3152 C  CB    . ILE G 3 52 ? 22.313  53.685  169.696 1.00 17.98 ? 370  ILE C CB    1 
ATOM   3153 C  CG1   . ILE G 3 52 ? 23.702  54.294  169.740 1.00 14.91 ? 370  ILE C CG1   1 
ATOM   3154 C  CG2   . ILE G 3 52 ? 22.043  53.264  168.286 1.00 18.11 ? 370  ILE C CG2   1 
ATOM   3155 C  CD1   . ILE G 3 52 ? 24.760  53.275  169.421 1.00 15.01 ? 370  ILE C CD1   1 
ATOM   3156 N  N     . ARG G 3 53 ? 19.340  53.184  170.511 1.00 14.10 ? 371  ARG C N     1 
ATOM   3157 C  CA    . ARG G 3 53 ? 18.001  52.695  170.205 1.00 16.20 ? 371  ARG C CA    1 
ATOM   3158 C  C     . ARG G 3 53 ? 16.980  53.765  170.493 1.00 20.85 ? 371  ARG C C     1 
ATOM   3159 O  O     . ARG G 3 53 ? 16.006  53.899  169.758 1.00 30.65 ? 371  ARG C O     1 
ATOM   3160 C  CB    . ARG G 3 53 ? 17.640  51.469  170.988 1.00 15.72 ? 371  ARG C CB    1 
ATOM   3161 C  CG    . ARG G 3 53 ? 18.595  50.347  170.806 1.00 24.28 ? 371  ARG C CG    1 
ATOM   3162 C  CD    . ARG G 3 53 ? 17.947  49.200  170.083 1.00 28.62 ? 371  ARG C CD    1 
ATOM   3163 N  NE    . ARG G 3 53 ? 18.099  49.344  168.653 1.00 33.51 ? 371  ARG C NE    1 
ATOM   3164 C  CZ    . ARG G 3 53 ? 18.332  48.344  167.812 1.00 33.56 ? 371  ARG C CZ    1 
ATOM   3165 N  NH1   . ARG G 3 53 ? 18.436  47.092  168.239 1.00 25.70 ? 371  ARG C NH1   1 
ATOM   3166 N  NH2   . ARG G 3 53 ? 18.521  48.616  166.534 1.00 35.02 ? 371  ARG C NH2   1 
ATOM   3167 N  N     . PHE G 3 54 ? 17.158  54.524  171.565 1.00 20.69 ? 372  PHE C N     1 
ATOM   3168 C  CA    . PHE G 3 54 ? 16.210  55.588  171.836 1.00 17.68 ? 372  PHE C CA    1 
ATOM   3169 C  C     . PHE G 3 54 ? 16.189  56.548  170.604 1.00 23.64 ? 372  PHE C C     1 
ATOM   3170 O  O     . PHE G 3 54 ? 15.143  56.800  169.997 1.00 25.09 ? 372  PHE C O     1 
ATOM   3171 C  CB    . PHE G 3 54 ? 16.584  56.345  173.118 1.00 16.19 ? 372  PHE C CB    1 
ATOM   3172 C  CG    . PHE G 3 54 ? 16.005  57.725  173.170 1.00 18.52 ? 372  PHE C CG    1 
ATOM   3173 C  CD1   . PHE G 3 54 ? 14.625  57.902  173.357 1.00 19.46 ? 372  PHE C CD1   1 
ATOM   3174 C  CD2   . PHE G 3 54 ? 16.792  58.832  172.811 1.00 15.26 ? 372  PHE C CD2   1 
ATOM   3175 C  CE1   . PHE G 3 54 ? 14.037  59.162  173.160 1.00 15.30 ? 372  PHE C CE1   1 
ATOM   3176 C  CE2   . PHE G 3 54 ? 16.224  60.086  172.608 1.00 11.65 ? 372  PHE C CE2   1 
ATOM   3177 C  CZ    . PHE G 3 54 ? 14.838  60.255  172.776 1.00 15.59 ? 372  PHE C CZ    1 
ATOM   3178 N  N     . LEU G 3 55 ? 17.365  57.056  170.244 1.00 27.29 ? 373  LEU C N     1 
ATOM   3179 C  CA    . LEU G 3 55 ? 17.557  57.952  169.123 1.00 16.16 ? 373  LEU C CA    1 
ATOM   3180 C  C     . LEU G 3 55 ? 17.031  57.335  167.865 1.00 20.64 ? 373  LEU C C     1 
ATOM   3181 O  O     . LEU G 3 55 ? 16.554  58.052  167.003 1.00 24.88 ? 373  LEU C O     1 
ATOM   3182 C  CB    . LEU G 3 55 ? 19.029  58.213  168.918 1.00 18.68 ? 373  LEU C CB    1 
ATOM   3183 C  CG    . LEU G 3 55 ? 19.746  59.039  169.967 1.00 14.47 ? 373  LEU C CG    1 
ATOM   3184 C  CD1   . LEU G 3 55 ? 21.241  59.099  169.658 1.00 15.74 ? 373  LEU C CD1   1 
ATOM   3185 C  CD2   . LEU G 3 55 ? 19.130  60.399  169.978 1.00 17.90 ? 373  LEU C CD2   1 
ATOM   3186 N  N     . GLN G 3 56 ? 17.137  56.022  167.719 1.00 19.78 ? 374  GLN C N     1 
ATOM   3187 C  CA    . GLN G 3 56 ? 16.634  55.404  166.514 1.00 16.56 ? 374  GLN C CA    1 
ATOM   3188 C  C     . GLN G 3 56 ? 15.126  55.447  166.520 1.00 24.45 ? 374  GLN C C     1 
ATOM   3189 O  O     . GLN G 3 56 ? 14.500  55.752  165.503 1.00 30.91 ? 374  GLN C O     1 
ATOM   3190 C  CB    . GLN G 3 56 ? 17.104  53.959  166.371 1.00 20.82 ? 374  GLN C CB    1 
ATOM   3191 C  CG    . GLN G 3 56 ? 18.598  53.776  166.108 1.00 16.44 ? 374  GLN C CG    1 
ATOM   3192 C  CD    . GLN G 3 56 ? 18.974  52.299  165.964 1.00 21.58 ? 374  GLN C CD    1 
ATOM   3193 O  OE1   . GLN G 3 56 ? 18.428  51.440  166.661 1.00 24.45 ? 374  GLN C OE1   1 
ATOM   3194 N  NE2   . GLN G 3 56 ? 19.866  51.993  165.021 1.00 19.93 ? 374  GLN C NE2   1 
ATOM   3195 N  N     . HIS G 3 57 ? 14.527  55.178  167.669 1.00 26.52 ? 375  HIS C N     1 
ATOM   3196 C  CA    . HIS G 3 57 ? 13.070  55.183  167.782 1.00 24.38 ? 375  HIS C CA    1 
ATOM   3197 C  C     . HIS G 3 57 ? 12.500  56.571  167.611 1.00 23.30 ? 375  HIS C C     1 
ATOM   3198 O  O     . HIS G 3 57 ? 11.476  56.773  166.982 1.00 25.66 ? 375  HIS C O     1 
ATOM   3199 C  CB    . HIS G 3 57 ? 12.669  54.626  169.131 1.00 25.65 ? 375  HIS C CB    1 
ATOM   3200 C  CG    . HIS G 3 57 ? 13.009  53.189  169.283 1.00 25.09 ? 375  HIS C CG    1 
ATOM   3201 N  ND1   . HIS G 3 57 ? 13.428  52.640  170.474 1.00 28.50 ? 375  HIS C ND1   1 
ATOM   3202 C  CD2   . HIS G 3 57 ? 12.988  52.180  168.390 1.00 28.18 ? 375  HIS C CD2   1 
ATOM   3203 C  CE1   . HIS G 3 57 ? 13.646  51.350  170.306 1.00 27.03 ? 375  HIS C CE1   1 
ATOM   3204 N  NE2   . HIS G 3 57 ? 13.382  51.045  169.050 1.00 30.44 ? 375  HIS C NE2   1 
ATOM   3205 N  N     . SER G 3 58 ? 13.158  57.526  168.230 1.00 27.25 ? 376  SER C N     1 
ATOM   3206 C  CA    . SER G 3 58 ? 12.758  58.903  168.137 1.00 28.60 ? 376  SER C CA    1 
ATOM   3207 C  C     . SER G 3 58 ? 12.800  59.270  166.667 1.00 28.95 ? 376  SER C C     1 
ATOM   3208 O  O     . SER G 3 58 ? 11.812  59.748  166.133 1.00 35.37 ? 376  SER C O     1 
ATOM   3209 C  CB    . SER G 3 58 ? 13.737  59.769  168.915 1.00 25.81 ? 376  SER C CB    1 
ATOM   3210 O  OG    . SER G 3 58 ? 13.394  61.134  168.796 1.00 37.48 ? 376  SER C OG    1 
ATOM   3211 N  N     . ASN G 3 59 ? 13.930  59.017  166.010 1.00 26.93 ? 377  ASN C N     1 
ATOM   3212 C  CA    . ASN G 3 59 ? 14.088  59.330  164.599 1.00 25.59 ? 377  ASN C CA    1 
ATOM   3213 C  C     . ASN G 3 59 ? 12.910  58.856  163.775 1.00 25.90 ? 377  ASN C C     1 
ATOM   3214 O  O     . ASN G 3 59 ? 12.386  59.601  162.943 1.00 31.00 ? 377  ASN C O     1 
ATOM   3215 C  CB    . ASN G 3 59 ? 15.334  58.690  164.056 1.00 24.13 ? 377  ASN C CB    1 
ATOM   3216 C  CG    . ASN G 3 59 ? 15.598  59.082  162.640 1.00 26.33 ? 377  ASN C CG    1 
ATOM   3217 O  OD1   . ASN G 3 59 ? 15.232  58.361  161.708 1.00 25.08 ? 377  ASN C OD1   1 
ATOM   3218 N  ND2   . ASN G 3 59 ? 16.238  60.230  162.461 1.00 22.35 ? 377  ASN C ND2   1 
ATOM   3219 N  N     . GLN G 3 60 ? 12.476  57.625  164.015 1.00 22.75 ? 378  GLN C N     1 
ATOM   3220 C  CA    . GLN G 3 60 ? 11.337  57.106  163.299 1.00 21.10 ? 378  GLN C CA    1 
ATOM   3221 C  C     . GLN G 3 60 ? 10.079  57.910  163.651 1.00 22.43 ? 378  GLN C C     1 
ATOM   3222 O  O     . GLN G 3 60 ? 9.331   58.290  162.775 1.00 31.65 ? 378  GLN C O     1 
ATOM   3223 C  CB    . GLN G 3 60 ? 11.124  55.629  163.600 1.00 20.51 ? 378  GLN C CB    1 
ATOM   3224 C  CG    . GLN G 3 60 ? 9.982   55.023  162.833 1.00 25.20 ? 378  GLN C CG    1 
ATOM   3225 C  CD    . GLN G 3 60 ? 9.286   53.911  163.578 1.00 38.01 ? 378  GLN C CD    1 
ATOM   3226 O  OE1   . GLN G 3 60 ? 8.947   54.062  164.760 1.00 53.50 ? 378  GLN C OE1   1 
ATOM   3227 N  NE2   . GLN G 3 60 ? 9.058   52.782  162.904 1.00 39.79 ? 378  GLN C NE2   1 
ATOM   3228 N  N     . LYS G 3 61 ? 9.855   58.219  164.918 1.00 26.01 ? 379  LYS C N     1 
ATOM   3229 C  CA    . LYS G 3 61 ? 8.667   58.972  165.299 1.00 21.15 ? 379  LYS C CA    1 
ATOM   3230 C  C     . LYS G 3 61 ? 8.699   60.368  164.715 1.00 22.94 ? 379  LYS C C     1 
ATOM   3231 O  O     . LYS G 3 61 ? 7.698   60.885  164.254 1.00 29.15 ? 379  LYS C O     1 
ATOM   3232 C  CB    . LYS G 3 61 ? 8.582   59.065  166.812 1.00 29.34 ? 379  LYS C CB    1 
ATOM   3233 C  CG    . LYS G 3 61 ? 8.360   57.742  167.493 1.00 38.42 ? 379  LYS C CG    1 
ATOM   3234 C  CD    . LYS G 3 61 ? 8.724   57.875  168.968 1.00 53.86 ? 379  LYS C CD    1 
ATOM   3235 C  CE    . LYS G 3 61 ? 8.838   56.508  169.673 1.00 57.66 ? 379  LYS C CE    1 
ATOM   3236 N  NZ    . LYS G 3 61 ? 9.505   56.641  171.019 1.00 59.91 ? 379  LYS C NZ    1 
ATOM   3237 N  N     . LEU G 3 62 ? 9.864   60.987  164.777 1.00 24.79 ? 380  LEU C N     1 
ATOM   3238 C  CA    . LEU G 3 62 ? 10.079  62.325  164.276 1.00 22.83 ? 380  LEU C CA    1 
ATOM   3239 C  C     . LEU G 3 62 ? 9.791   62.370  162.773 1.00 27.07 ? 380  LEU C C     1 
ATOM   3240 O  O     . LEU G 3 62 ? 9.243   63.362  162.268 1.00 25.38 ? 380  LEU C O     1 
ATOM   3241 C  CB    . LEU G 3 62 ? 11.528  62.757  164.565 1.00 19.98 ? 380  LEU C CB    1 
ATOM   3242 C  CG    . LEU G 3 62 ? 11.890  63.143  165.993 1.00 17.36 ? 380  LEU C CG    1 
ATOM   3243 C  CD1   . LEU G 3 62 ? 13.331  63.480  166.104 1.00 22.08 ? 380  LEU C CD1   1 
ATOM   3244 C  CD2   . LEU G 3 62 ? 11.101  64.364  166.377 1.00 24.01 ? 380  LEU C CD2   1 
ATOM   3245 N  N     . LYS G 3 63 ? 10.196  61.319  162.057 1.00 24.32 ? 381  LYS C N     1 
ATOM   3246 C  CA    . LYS G 3 63 ? 9.964   61.253  160.626 1.00 22.90 ? 381  LYS C CA    1 
ATOM   3247 C  C     . LYS G 3 63 ? 8.504   61.036  160.311 1.00 24.87 ? 381  LYS C C     1 
ATOM   3248 O  O     . LYS G 3 63 ? 7.968   61.662  159.412 1.00 30.73 ? 381  LYS C O     1 
ATOM   3249 C  CB    . LYS G 3 63 ? 10.780  60.154  159.992 1.00 16.37 ? 381  LYS C CB    1 
ATOM   3250 C  CG    . LYS G 3 63 ? 12.203  60.514  159.804 1.00 18.44 ? 381  LYS C CG    1 
ATOM   3251 C  CD    . LYS G 3 63 ? 12.866  59.380  159.128 1.00 20.97 ? 381  LYS C CD    1 
ATOM   3252 C  CE    . LYS G 3 63 ? 14.315  59.701  158.805 1.00 33.93 ? 381  LYS C CE    1 
ATOM   3253 N  NZ    . LYS G 3 63 ? 15.063  58.444  158.388 1.00 42.23 ? 381  LYS C NZ    1 
ATOM   3254 N  N     . GLN G 3 64 ? 7.859   60.136  161.032 1.00 26.05 ? 382  GLN C N     1 
ATOM   3255 C  CA    . GLN G 3 64 ? 6.446   59.883  160.826 1.00 27.50 ? 382  GLN C CA    1 
ATOM   3256 C  C     . GLN G 3 64 ? 5.692   61.193  161.037 1.00 29.06 ? 382  GLN C C     1 
ATOM   3257 O  O     . GLN G 3 64 ? 4.786   61.505  160.283 1.00 32.24 ? 382  GLN C O     1 
ATOM   3258 C  CB    . GLN G 3 64 ? 5.963   58.810  161.797 1.00 29.32 ? 382  GLN C CB    1 
ATOM   3259 C  CG    . GLN G 3 64 ? 4.475   58.758  162.023 1.00 37.57 ? 382  GLN C CG    1 
ATOM   3260 C  CD    . GLN G 3 64 ? 3.709   58.423  160.772 1.00 51.81 ? 382  GLN C CD    1 
ATOM   3261 O  OE1   . GLN G 3 64 ? 3.671   57.264  160.353 1.00 60.68 ? 382  GLN C OE1   1 
ATOM   3262 N  NE2   . GLN G 3 64 ? 3.093   59.432  160.153 1.00 56.17 ? 382  GLN C NE2   1 
ATOM   3263 N  N     . GLU G 3 65 ? 6.111   61.997  162.009 1.00 30.24 ? 383  GLU C N     1 
ATOM   3264 C  CA    . GLU G 3 65 ? 5.433   63.267  162.271 1.00 30.53 ? 383  GLU C CA    1 
ATOM   3265 C  C     . GLU G 3 65 ? 5.697   64.358  161.238 1.00 32.39 ? 383  GLU C C     1 
ATOM   3266 O  O     . GLU G 3 65 ? 4.856   65.233  161.018 1.00 37.53 ? 383  GLU C O     1 
ATOM   3267 C  CB    . GLU G 3 65 ? 5.781   63.820  163.644 1.00 27.99 ? 383  GLU C CB    1 
ATOM   3268 C  CG    . GLU G 3 65 ? 4.671   64.694  164.165 1.00 37.30 ? 383  GLU C CG    1 
ATOM   3269 C  CD    . GLU G 3 65 ? 5.171   65.928  164.875 1.00 53.00 ? 383  GLU C CD    1 
ATOM   3270 O  OE1   . GLU G 3 65 ? 6.396   65.966  165.176 1.00 58.90 ? 383  GLU C OE1   1 
ATOM   3271 O  OE2   . GLU G 3 65 ? 4.335   66.852  165.136 1.00 59.15 ? 383  GLU C OE2   1 
ATOM   3272 N  N     . ASN G 3 66 ? 6.906   64.367  160.696 1.00 29.52 ? 384  ASN C N     1 
ATOM   3273 C  CA    . ASN G 3 66 ? 7.318   65.322  159.687 1.00 27.00 ? 384  ASN C CA    1 
ATOM   3274 C  C     . ASN G 3 66 ? 6.465   65.100  158.440 1.00 27.34 ? 384  ASN C C     1 
ATOM   3275 O  O     . ASN G 3 66 ? 5.979   66.033  157.839 1.00 30.98 ? 384  ASN C O     1 
ATOM   3276 C  CB    . ASN G 3 66 ? 8.772   65.059  159.358 1.00 27.74 ? 384  ASN C CB    1 
ATOM   3277 C  CG    . ASN G 3 66 ? 9.347   66.084  158.441 1.00 37.64 ? 384  ASN C CG    1 
ATOM   3278 O  OD1   . ASN G 3 66 ? 9.453   65.858  157.229 1.00 36.64 ? 384  ASN C OD1   1 
ATOM   3279 N  ND2   . ASN G 3 66 ? 9.778   67.210  159.007 1.00 30.03 ? 384  ASN C ND2   1 
ATOM   3280 N  N     . LEU G 3 67 ? 6.271   63.843  158.071 1.00 29.96 ? 385  LEU C N     1 
ATOM   3281 C  CA    . LEU G 3 67 ? 5.471   63.484  156.916 1.00 31.02 ? 385  LEU C CA    1 
ATOM   3282 C  C     . LEU G 3 67 ? 4.014   63.871  157.130 1.00 34.63 ? 385  LEU C C     1 
ATOM   3283 O  O     . LEU G 3 67 ? 3.342   64.318  156.195 1.00 37.97 ? 385  LEU C O     1 
ATOM   3284 C  CB    . LEU G 3 67 ? 5.575   61.987  156.631 1.00 28.75 ? 385  LEU C CB    1 
ATOM   3285 C  CG    . LEU G 3 67 ? 4.940   61.518  155.310 1.00 37.60 ? 385  LEU C CG    1 
ATOM   3286 C  CD1   . LEU G 3 67 ? 5.620   62.168  154.100 1.00 36.83 ? 385  LEU C CD1   1 
ATOM   3287 C  CD2   . LEU G 3 67 ? 5.050   60.018  155.191 1.00 34.38 ? 385  LEU C CD2   1 
ATOM   3288 N  N     . SER G 3 68 ? 3.510   63.661  158.339 1.00 31.68 ? 386  SER C N     1 
ATOM   3289 C  CA    . SER G 3 68 ? 2.142   64.011  158.649 1.00 27.97 ? 386  SER C CA    1 
ATOM   3290 C  C     . SER G 3 68 ? 2.025   65.503  158.584 1.00 28.39 ? 386  SER C C     1 
ATOM   3291 O  O     . SER G 3 68 ? 1.120   66.014  157.950 1.00 36.52 ? 386  SER C O     1 
ATOM   3292 C  CB    . SER G 3 68 ? 1.758   63.532  160.041 1.00 31.45 ? 386  SER C CB    1 
ATOM   3293 O  OG    . SER G 3 68 ? 1.574   62.122  160.040 1.00 49.95 ? 386  SER C OG    1 
ATOM   3294 N  N     . LEU G 3 69 ? 2.934   66.214  159.233 1.00 28.51 ? 387  LEU C N     1 
ATOM   3295 C  CA    . LEU G 3 69 ? 2.895   67.661  159.200 1.00 27.85 ? 387  LEU C CA    1 
ATOM   3296 C  C     . LEU G 3 69 ? 2.930   68.153  157.752 1.00 32.79 ? 387  LEU C C     1 
ATOM   3297 O  O     . LEU G 3 69 ? 2.145   69.022  157.382 1.00 39.55 ? 387  LEU C O     1 
ATOM   3298 C  CB    . LEU G 3 69 ? 4.039   68.261  160.016 1.00 25.43 ? 387  LEU C CB    1 
ATOM   3299 C  CG    . LEU G 3 69 ? 3.815   68.141  161.522 1.00 24.86 ? 387  LEU C CG    1 
ATOM   3300 C  CD1   . LEU G 3 69 ? 4.920   68.794  162.334 1.00 24.26 ? 387  LEU C CD1   1 
ATOM   3301 C  CD2   . LEU G 3 69 ? 2.502   68.819  161.826 1.00 31.42 ? 387  LEU C CD2   1 
ATOM   3302 N  N     . ARG G 3 70 ? 3.790   67.559  156.925 1.00 33.19 ? 388  ARG C N     1 
ATOM   3303 C  CA    . ARG G 3 70 ? 3.907   67.931  155.506 1.00 31.81 ? 388  ARG C CA    1 
ATOM   3304 C  C     . ARG G 3 70 ? 2.653   67.573  154.745 1.00 31.76 ? 388  ARG C C     1 
ATOM   3305 O  O     . ARG G 3 70 ? 2.237   68.301  153.856 1.00 34.59 ? 388  ARG C O     1 
ATOM   3306 C  CB    . ARG G 3 70 ? 5.075   67.211  154.827 1.00 27.33 ? 388  ARG C CB    1 
ATOM   3307 C  CG    . ARG G 3 70 ? 6.413   67.759  155.164 1.00 22.82 ? 388  ARG C CG    1 
ATOM   3308 C  CD    . ARG G 3 70 ? 7.497   66.812  154.730 1.00 21.85 ? 388  ARG C CD    1 
ATOM   3309 N  NE    . ARG G 3 70 ? 8.789   67.372  155.107 1.00 28.32 ? 388  ARG C NE    1 
ATOM   3310 C  CZ    . ARG G 3 70 ? 9.431   68.301  154.408 1.00 31.19 ? 388  ARG C CZ    1 
ATOM   3311 N  NH1   . ARG G 3 70 ? 8.910   68.771  153.279 1.00 35.25 ? 388  ARG C NH1   1 
ATOM   3312 N  NH2   . ARG G 3 70 ? 10.567  68.803  154.865 1.00 30.63 ? 388  ARG C NH2   1 
ATOM   3313 N  N     . THR G 3 71 ? 2.080   66.421  155.046 1.00 28.23 ? 389  THR C N     1 
ATOM   3314 C  CA    . THR G 3 71 ? 0.889   66.038  154.360 1.00 28.15 ? 389  THR C CA    1 
ATOM   3315 C  C     . THR G 3 71 ? -0.231  66.938  154.791 1.00 33.54 ? 389  THR C C     1 
ATOM   3316 O  O     . THR G 3 71 ? -1.145  67.200  154.024 1.00 45.59 ? 389  THR C O     1 
ATOM   3317 C  CB    . THR G 3 71 ? 0.507   64.639  154.659 1.00 28.05 ? 389  THR C CB    1 
ATOM   3318 O  OG1   . THR G 3 71 ? 1.552   63.769  154.220 1.00 36.25 ? 389  THR C OG1   1 
ATOM   3319 C  CG2   . THR G 3 71 ? -0.747  64.295  153.905 1.00 29.28 ? 389  THR C CG2   1 
ATOM   3320 N  N     . ALA G 3 72 ? -0.156  67.458  156.005 1.00 37.05 ? 390  ALA C N     1 
ATOM   3321 C  CA    . ALA G 3 72 ? -1.210  68.334  156.477 1.00 34.93 ? 390  ALA C CA    1 
ATOM   3322 C  C     . ALA G 3 72 ? -1.171  69.679  155.766 1.00 34.73 ? 390  ALA C C     1 
ATOM   3323 O  O     . ALA G 3 72 ? -2.177  70.088  155.198 1.00 38.69 ? 390  ALA C O     1 
ATOM   3324 C  CB    . ALA G 3 72 ? -1.121  68.520  157.964 1.00 31.59 ? 390  ALA C CB    1 
ATOM   3325 N  N     . VAL G 3 73 ? -0.024  70.363  155.781 1.00 34.92 ? 391  VAL C N     1 
ATOM   3326 C  CA    . VAL G 3 73 ? 0.065   71.665  155.126 1.00 35.72 ? 391  VAL C CA    1 
ATOM   3327 C  C     . VAL G 3 73 ? -0.256  71.540  153.624 1.00 39.91 ? 391  VAL C C     1 
ATOM   3328 O  O     . VAL G 3 73 ? -0.942  72.385  153.045 1.00 42.44 ? 391  VAL C O     1 
ATOM   3329 C  CB    . VAL G 3 73 ? 1.413   72.404  155.394 1.00 26.57 ? 391  VAL C CB    1 
ATOM   3330 C  CG1   . VAL G 3 73 ? 1.946   72.061  156.722 1.00 26.91 ? 391  VAL C CG1   1 
ATOM   3331 C  CG2   . VAL G 3 73 ? 2.405   72.131  154.358 1.00 30.82 ? 391  VAL C CG2   1 
ATOM   3332 N  N     . HIS G 3 74 ? 0.162   70.441  153.012 1.00 38.50 ? 392  HIS C N     1 
ATOM   3333 C  CA    . HIS G 3 74 ? -0.128  70.239  151.613 1.00 32.69 ? 392  HIS C CA    1 
ATOM   3334 C  C     . HIS G 3 74 ? -1.616  70.241  151.442 1.00 35.90 ? 392  HIS C C     1 
ATOM   3335 O  O     . HIS G 3 74 ? -2.129  71.004  150.659 1.00 49.03 ? 392  HIS C O     1 
ATOM   3336 C  CB    . HIS G 3 74 ? 0.384   68.918  151.135 1.00 36.36 ? 392  HIS C CB    1 
ATOM   3337 C  CG    . HIS G 3 74 ? 0.182   68.709  149.673 1.00 47.91 ? 392  HIS C CG    1 
ATOM   3338 N  ND1   . HIS G 3 74 ? -0.750  67.826  149.171 1.00 49.78 ? 392  HIS C ND1   1 
ATOM   3339 C  CD2   . HIS G 3 74 ? 0.789   69.272  148.601 1.00 43.91 ? 392  HIS C CD2   1 
ATOM   3340 C  CE1   . HIS G 3 74 ? -0.711  67.853  147.851 1.00 52.79 ? 392  HIS C CE1   1 
ATOM   3341 N  NE2   . HIS G 3 74 ? 0.214   68.722  147.480 1.00 56.47 ? 392  HIS C NE2   1 
ATOM   3342 N  N     . LYS G 3 75 ? -2.311  69.370  152.160 1.00 36.72 ? 393  LYS C N     1 
ATOM   3343 C  CA    . LYS G 3 75 ? -3.765  69.296  152.097 1.00 35.26 ? 393  LYS C CA    1 
ATOM   3344 C  C     . LYS G 3 75 ? -4.437  70.646  152.401 1.00 35.80 ? 393  LYS C C     1 
ATOM   3345 O  O     . LYS G 3 75 ? -5.495  70.955  151.848 1.00 37.43 ? 393  LYS C O     1 
ATOM   3346 C  CB    . LYS G 3 75 ? -4.282  68.212  153.052 1.00 34.53 ? 393  LYS C CB    1 
ATOM   3347 N  N     . SER G 3 76 ? -3.810  71.465  153.238 1.00 35.50 ? 394  SER C N     1 
ATOM   3348 C  CA    . SER G 3 76 ? -4.386  72.758  153.576 1.00 39.76 ? 394  SER C CA    1 
ATOM   3349 C  C     . SER G 3 76 ? -4.486  73.621  152.323 1.00 47.34 ? 394  SER C C     1 
ATOM   3350 O  O     . SER G 3 76 ? -5.339  74.510  152.222 1.00 58.59 ? 394  SER C O     1 
ATOM   3351 C  CB    . SER G 3 76 ? -3.544  73.475  154.627 1.00 36.31 ? 394  SER C CB    1 
ATOM   3352 O  OG    . SER G 3 76 ? -2.379  74.041  154.058 1.00 45.11 ? 394  SER C OG    1 
ATOM   3353 N  N     . LYS G 3 77 ? -3.587  73.373  151.380 1.00 49.92 ? 395  LYS C N     1 
ATOM   3354 C  CA    . LYS G 3 77 ? -3.561  74.107  150.127 1.00 49.21 ? 395  LYS C CA    1 
ATOM   3355 C  C     . LYS G 3 77 ? -4.727  73.725  149.209 1.00 46.83 ? 395  LYS C C     1 
ATOM   3356 O  O     . LYS G 3 77 ? -5.236  74.553  148.472 1.00 46.90 ? 395  LYS C O     1 
ATOM   3357 C  CB    . LYS G 3 77 ? -2.197  73.893  149.461 1.00 50.49 ? 395  LYS C CB    1 
ATOM   3358 C  CG    . LYS G 3 77 ? -1.054  74.415  150.337 1.00 48.92 ? 395  LYS C CG    1 
ATOM   3359 C  CD    . LYS G 3 77 ? 0.327   74.014  149.844 1.00 51.41 ? 395  LYS C CD    1 
ATOM   3360 C  CE    . LYS G 3 77 ? 1.404   74.678  150.725 1.00 60.90 ? 395  LYS C CE    1 
ATOM   3361 N  NZ    . LYS G 3 77 ? 2.833   74.335  150.390 1.00 57.87 ? 395  LYS C NZ    1 
ATOM   3362 N  N     . SER G 3 78 ? -5.203  72.494  149.302 1.00 48.39 ? 396  SER C N     1 
ATOM   3363 C  CA    . SER G 3 78 ? -6.307  72.075  148.463 1.00 50.85 ? 396  SER C CA    1 
ATOM   3364 C  C     . SER G 3 78 ? -7.628  72.786  148.751 1.00 54.51 ? 396  SER C C     1 
ATOM   3365 O  O     . SER G 3 78 ? -8.251  72.581  149.787 1.00 61.02 ? 396  SER C O     1 
ATOM   3366 C  CB    . SER G 3 78 ? -6.530  70.574  148.553 1.00 54.82 ? 396  SER C CB    1 
ATOM   3367 O  OG    . SER G 3 78 ? -7.549  70.198  147.633 1.00 56.49 ? 396  SER C OG    1 
ATOM   3368 N  N     . LEU G 3 79 ? -8.062  73.611  147.809 1.00 54.98 ? 397  LEU C N     1 
ATOM   3369 C  CA    . LEU G 3 79 ? -9.309  74.338  147.942 1.00 52.39 ? 397  LEU C CA    1 
ATOM   3370 C  C     . LEU G 3 79 ? -10.432 73.683  147.128 1.00 57.31 ? 397  LEU C C     1 
ATOM   3371 O  O     . LEU G 3 79 ? -11.610 74.022  147.296 1.00 57.60 ? 397  LEU C O     1 
ATOM   3372 C  CB    . LEU G 3 79 ? -9.116  75.780  147.477 1.00 50.60 ? 397  LEU C CB    1 
ATOM   3373 C  CG    . LEU G 3 79 ? -7.982  76.583  148.111 1.00 52.41 ? 397  LEU C CG    1 
ATOM   3374 C  CD1   . LEU G 3 79 ? -8.282  78.081  147.930 1.00 50.20 ? 397  LEU C CD1   1 
ATOM   3375 C  CD2   . LEU G 3 79 ? -7.848  76.224  149.594 1.00 53.40 ? 397  LEU C CD2   1 
ATOM   3376 N  N     . LYS G 3 80 ? -10.059 72.760  146.244 1.00 53.23 ? 398  LYS C N     1 
ATOM   3377 C  CA    . LYS G 3 80 ? -11.001 72.061  145.371 1.00 53.12 ? 398  LYS C CA    1 
ATOM   3378 C  C     . LYS G 3 80 ? -12.447 72.003  145.879 1.00 54.07 ? 398  LYS C C     1 
ATOM   3379 O  O     . LYS G 3 80 ? -12.688 71.648  147.042 1.00 53.66 ? 398  LYS C O     1 
ATOM   3380 C  CB    . LYS G 3 80 ? -10.509 70.640  145.098 1.00 43.30 ? 398  LYS C CB    1 
ATOM   3381 C  CG    . LYS G 3 80 ? -9.159  70.548  144.457 1.00 42.33 ? 398  LYS C CG    1 
ATOM   3382 C  CD    . LYS G 3 80 ? -8.819  69.099  144.220 1.00 46.50 ? 398  LYS C CD    1 
ATOM   3383 C  CE    . LYS G 3 80 ? -7.418  68.923  143.655 1.00 56.46 ? 398  LYS C CE    1 
ATOM   3384 N  NZ    . LYS G 3 80 ? -7.088  67.491  143.332 1.00 61.29 ? 398  LYS C NZ    1 
ATOM   3385 N  N     . ASP G 3 81 ? -13.390 72.400  145.017 1.00 54.61 ? 399  ASP C N     1 
ATOM   3386 C  CA    . ASP G 3 81 ? -14.823 72.373  145.328 1.00 53.29 ? 399  ASP C CA    1 
ATOM   3387 C  C     . ASP G 3 81 ? -15.218 70.963  145.763 1.00 56.53 ? 399  ASP C C     1 
ATOM   3388 O  O     . ASP G 3 81 ? -15.297 70.041  144.930 1.00 55.22 ? 399  ASP C O     1 
ATOM   3389 C  CB    . ASP G 3 81 ? -15.654 72.803  144.120 1.00 47.77 ? 399  ASP C CB    1 
ATOM   3390 N  N     . LEU G 3 82 ? -15.380 70.817  147.086 1.00 59.24 ? 400  LEU C N     1 
ATOM   3391 C  CA    . LEU G 3 82 ? -15.760 69.570  147.767 1.00 59.67 ? 400  LEU C CA    1 
ATOM   3392 C  C     . LEU G 3 82 ? -17.278 69.495  147.962 1.00 61.29 ? 400  LEU C C     1 
ATOM   3393 O  O     . LEU G 3 82 ? -17.789 68.374  148.205 1.00 64.65 ? 400  LEU C O     1 
ATOM   3394 C  CB    . LEU G 3 82 ? -15.050 69.479  149.143 1.00 56.52 ? 400  LEU C CB    1 
ATOM   3395 N  N     . GLN H 3 1  ? 43.873  30.698  198.920 1.00 55.05 ? 319  GLN D N     1 
ATOM   3396 C  CA    . GLN H 3 1  ? 44.473  31.735  199.826 1.00 56.95 ? 319  GLN D CA    1 
ATOM   3397 C  C     . GLN H 3 1  ? 45.969  31.950  199.548 1.00 56.37 ? 319  GLN D C     1 
ATOM   3398 O  O     . GLN H 3 1  ? 46.609  32.841  200.121 1.00 50.68 ? 319  GLN D O     1 
ATOM   3399 C  CB    . GLN H 3 1  ? 44.223  31.395  201.322 1.00 55.29 ? 319  GLN D CB    1 
ATOM   3400 N  N     . SER H 3 2  ? 46.553  31.088  198.726 1.00 57.07 ? 320  SER D N     1 
ATOM   3401 C  CA    . SER H 3 2  ? 47.943  31.298  198.354 1.00 59.04 ? 320  SER D CA    1 
ATOM   3402 C  C     . SER H 3 2  ? 47.875  32.573  197.488 1.00 61.32 ? 320  SER D C     1 
ATOM   3403 O  O     . SER H 3 2  ? 46.789  32.956  197.007 1.00 59.78 ? 320  SER D O     1 
ATOM   3404 C  CB    . SER H 3 2  ? 48.466  30.126  197.531 1.00 53.06 ? 320  SER D CB    1 
ATOM   3405 N  N     . ARG H 3 3  ? 49.007  33.251  197.316 1.00 62.66 ? 321  ARG D N     1 
ATOM   3406 C  CA    . ARG H 3 3  ? 49.026  34.460  196.499 1.00 59.28 ? 321  ARG D CA    1 
ATOM   3407 C  C     . ARG H 3 3  ? 48.482  34.018  195.144 1.00 59.21 ? 321  ARG D C     1 
ATOM   3408 O  O     . ARG H 3 3  ? 47.434  34.479  194.716 1.00 58.19 ? 321  ARG D O     1 
ATOM   3409 C  CB    . ARG H 3 3  ? 50.452  35.007  196.369 1.00 54.04 ? 321  ARG D CB    1 
ATOM   3410 N  N     . GLY H 3 4  ? 49.123  33.002  194.571 1.00 58.98 ? 322  GLY D N     1 
ATOM   3411 C  CA    . GLY H 3 4  ? 48.708  32.464  193.289 1.00 57.07 ? 322  GLY D CA    1 
ATOM   3412 C  C     . GLY H 3 4  ? 47.271  31.991  193.312 1.00 51.36 ? 322  GLY D C     1 
ATOM   3413 O  O     . GLY H 3 4  ? 46.579  32.076  192.302 1.00 55.09 ? 322  GLY D O     1 
ATOM   3414 N  N     . GLU H 3 5  ? 46.810  31.489  194.452 1.00 50.19 ? 323  GLU D N     1 
ATOM   3415 C  CA    . GLU H 3 5  ? 45.433  31.038  194.532 1.00 49.81 ? 323  GLU D CA    1 
ATOM   3416 C  C     . GLU H 3 5  ? 44.584  32.284  194.475 1.00 55.17 ? 323  GLU D C     1 
ATOM   3417 O  O     . GLU H 3 5  ? 43.525  32.304  193.841 1.00 58.79 ? 323  GLU D O     1 
ATOM   3418 C  CB    . GLU H 3 5  ? 45.150  30.285  195.831 1.00 54.73 ? 323  GLU D CB    1 
ATOM   3419 C  CG    . GLU H 3 5  ? 45.651  28.857  195.855 1.00 55.53 ? 323  GLU D CG    1 
ATOM   3420 C  CD    . GLU H 3 5  ? 45.010  28.044  196.962 1.00 64.66 ? 323  GLU D CD    1 
ATOM   3421 O  OE1   . GLU H 3 5  ? 45.396  28.229  198.141 1.00 67.81 ? 323  GLU D OE1   1 
ATOM   3422 O  OE2   . GLU H 3 5  ? 44.115  27.225  196.644 1.00 62.72 ? 323  GLU D OE2   1 
ATOM   3423 N  N     . LYS H 3 6  ? 45.096  33.343  195.090 1.00 48.62 ? 324  LYS D N     1 
ATOM   3424 C  CA    . LYS H 3 6  ? 44.413  34.619  195.124 1.00 56.60 ? 324  LYS D CA    1 
ATOM   3425 C  C     . LYS H 3 6  ? 44.482  35.353  193.750 1.00 54.47 ? 324  LYS D C     1 
ATOM   3426 O  O     . LYS H 3 6  ? 43.523  36.028  193.341 1.00 58.93 ? 324  LYS D O     1 
ATOM   3427 C  CB    . LYS H 3 6  ? 44.988  35.465  196.245 1.00 54.84 ? 324  LYS D CB    1 
ATOM   3428 N  N     . ARG H 3 7  ? 45.584  35.176  193.019 1.00 46.69 ? 325  ARG D N     1 
ATOM   3429 C  CA    . ARG H 3 7  ? 45.746  35.795  191.708 1.00 39.94 ? 325  ARG D CA    1 
ATOM   3430 C  C     . ARG H 3 7  ? 44.784  35.105  190.786 1.00 36.82 ? 325  ARG D C     1 
ATOM   3431 O  O     . ARG H 3 7  ? 44.052  35.753  190.056 1.00 37.08 ? 325  ARG D O     1 
ATOM   3432 C  CB    . ARG H 3 7  ? 47.166  35.611  191.159 1.00 44.44 ? 325  ARG D CB    1 
ATOM   3433 C  CG    . ARG H 3 7  ? 48.165  36.724  191.497 1.00 48.13 ? 325  ARG D CG    1 
ATOM   3434 C  CD    . ARG H 3 7  ? 48.126  37.899  190.502 1.00 51.40 ? 325  ARG D CD    1 
ATOM   3435 N  NE    . ARG H 3 7  ? 46.965  38.791  190.629 1.00 53.10 ? 325  ARG D NE    1 
ATOM   3436 C  CZ    . ARG H 3 7  ? 46.078  39.022  189.657 1.00 51.22 ? 325  ARG D CZ    1 
ATOM   3437 N  NH1   . ARG H 3 7  ? 46.214  38.412  188.484 1.00 52.20 ? 325  ARG D NH1   1 
ATOM   3438 N  NH2   . ARG H 3 7  ? 45.085  39.897  189.834 1.00 43.97 ? 325  ARG D NH2   1 
ATOM   3439 N  N     . THR H 3 8  ? 44.743  33.785  190.862 1.00 31.97 ? 326  THR D N     1 
ATOM   3440 C  CA    . THR H 3 8  ? 43.858  33.022  190.007 1.00 37.89 ? 326  THR D CA    1 
ATOM   3441 C  C     . THR H 3 8  ? 42.399  33.377  190.212 1.00 38.74 ? 326  THR D C     1 
ATOM   3442 O  O     . THR H 3 8  ? 41.639  33.522  189.234 1.00 34.99 ? 326  THR D O     1 
ATOM   3443 C  CB    . THR H 3 8  ? 44.063  31.536  190.213 1.00 42.70 ? 326  THR D CB    1 
ATOM   3444 O  OG1   . THR H 3 8  ? 45.410  31.210  189.851 1.00 52.73 ? 326  THR D OG1   1 
ATOM   3445 C  CG2   . THR H 3 8  ? 43.080  30.719  189.358 1.00 47.38 ? 326  THR D CG2   1 
ATOM   3446 N  N     . ALA H 3 9  ? 42.005  33.505  191.480 1.00 36.47 ? 327  ALA D N     1 
ATOM   3447 C  CA    . ALA H 3 9  ? 40.635  33.867  191.800 1.00 35.15 ? 327  ALA D CA    1 
ATOM   3448 C  C     . ALA H 3 9  ? 40.330  35.241  191.202 1.00 35.18 ? 327  ALA D C     1 
ATOM   3449 O  O     . ALA H 3 9  ? 39.323  35.403  190.520 1.00 33.86 ? 327  ALA D O     1 
ATOM   3450 C  CB    . ALA H 3 9  ? 40.428  33.902  193.288 1.00 36.86 ? 327  ALA D CB    1 
ATOM   3451 N  N     . HIS H 3 10 ? 41.201  36.224  191.437 1.00 33.20 ? 328  HIS D N     1 
ATOM   3452 C  CA    . HIS H 3 10 ? 40.948  37.543  190.885 1.00 33.99 ? 328  HIS D CA    1 
ATOM   3453 C  C     . HIS H 3 10 ? 41.023  37.516  189.362 1.00 34.82 ? 328  HIS D C     1 
ATOM   3454 O  O     . HIS H 3 10 ? 40.344  38.268  188.679 1.00 40.35 ? 328  HIS D O     1 
ATOM   3455 C  CB    . HIS H 3 10 ? 41.856  38.621  191.460 1.00 30.77 ? 328  HIS D CB    1 
ATOM   3456 C  CG    . HIS H 3 10 ? 41.256  39.998  191.366 1.00 40.01 ? 328  HIS D CG    1 
ATOM   3457 N  ND1   . HIS H 3 10 ? 41.664  40.934  190.440 1.00 41.87 ? 328  HIS D ND1   1 
ATOM   3458 C  CD2   . HIS H 3 10 ? 40.270  40.592  192.085 1.00 39.20 ? 328  HIS D CD2   1 
ATOM   3459 C  CE1   . HIS H 3 10 ? 40.968  42.046  190.595 1.00 36.26 ? 328  HIS D CE1   1 
ATOM   3460 N  NE2   . HIS H 3 10 ? 40.115  41.867  191.587 1.00 39.78 ? 328  HIS D NE2   1 
ATOM   3461 N  N     . ASN H 3 11 ? 41.795  36.596  188.822 1.00 32.31 ? 329  ASN D N     1 
ATOM   3462 C  CA    . ASN H 3 11 ? 41.874  36.484  187.395 1.00 29.36 ? 329  ASN D CA    1 
ATOM   3463 C  C     . ASN H 3 11 ? 40.483  36.168  186.874 1.00 28.45 ? 329  ASN D C     1 
ATOM   3464 O  O     . ASN H 3 11 ? 40.042  36.752  185.885 1.00 36.00 ? 329  ASN D O     1 
ATOM   3465 C  CB    . ASN H 3 11 ? 42.922  35.438  187.003 1.00 27.41 ? 329  ASN D CB    1 
ATOM   3466 C  CG    . ASN H 3 11 ? 44.332  36.048  186.930 1.00 32.92 ? 329  ASN D CG    1 
ATOM   3467 O  OD1   . ASN H 3 11 ? 44.483  37.285  186.901 1.00 28.19 ? 329  ASN D OD1   1 
ATOM   3468 N  ND2   . ASN H 3 11 ? 45.357  35.203  186.886 1.00 30.12 ? 329  ASN D ND2   1 
ATOM   3469 N  N     . ALA H 3 12 ? 39.736  35.340  187.594 1.00 31.25 ? 330  ALA D N     1 
ATOM   3470 C  CA    . ALA H 3 12 ? 38.370  35.000  187.166 1.00 28.02 ? 330  ALA D CA    1 
ATOM   3471 C  C     . ALA H 3 12 ? 37.424  36.174  187.304 1.00 26.86 ? 330  ALA D C     1 
ATOM   3472 O  O     . ALA H 3 12 ? 36.436  36.258  186.584 1.00 30.14 ? 330  ALA D O     1 
ATOM   3473 C  CB    . ALA H 3 12 ? 37.848  33.848  187.947 1.00 31.22 ? 330  ALA D CB    1 
ATOM   3474 N  N     . ILE H 3 13 ? 37.755  37.085  188.209 1.00 19.45 ? 331  ILE D N     1 
ATOM   3475 C  CA    . ILE H 3 13 ? 36.970  38.271  188.459 1.00 23.47 ? 331  ILE D CA    1 
ATOM   3476 C  C     . ILE H 3 13 ? 37.254  39.287  187.369 1.00 27.74 ? 331  ILE D C     1 
ATOM   3477 O  O     . ILE H 3 13 ? 36.348  39.989  186.887 1.00 31.01 ? 331  ILE D O     1 
ATOM   3478 C  CB    . ILE H 3 13 ? 37.315  38.840  189.851 1.00 19.53 ? 331  ILE D CB    1 
ATOM   3479 C  CG1   . ILE H 3 13 ? 36.673  37.969  190.918 1.00 25.83 ? 331  ILE D CG1   1 
ATOM   3480 C  CG2   . ILE H 3 13 ? 36.862  40.290  190.035 1.00 17.13 ? 331  ILE D CG2   1 
ATOM   3481 C  CD1   . ILE H 3 13 ? 37.114  38.352  192.316 1.00 32.81 ? 331  ILE D CD1   1 
ATOM   3482 N  N     . GLU H 3 14 ? 38.518  39.348  186.964 1.00 28.20 ? 332  GLU D N     1 
ATOM   3483 C  CA    . GLU H 3 14 ? 38.951  40.258  185.923 1.00 23.01 ? 332  GLU D CA    1 
ATOM   3484 C  C     . GLU H 3 14 ? 38.365  39.829  184.576 1.00 23.42 ? 332  GLU D C     1 
ATOM   3485 O  O     . GLU H 3 14 ? 37.991  40.670  183.758 1.00 24.16 ? 332  GLU D O     1 
ATOM   3486 C  CB    . GLU H 3 14 ? 40.463  40.311  185.878 1.00 30.23 ? 332  GLU D CB    1 
ATOM   3487 C  CG    . GLU H 3 14 ? 41.071  40.836  187.146 1.00 33.71 ? 332  GLU D CG    1 
ATOM   3488 C  CD    . GLU H 3 14 ? 42.582  40.724  187.167 1.00 43.85 ? 332  GLU D CD    1 
ATOM   3489 O  OE1   . GLU H 3 14 ? 43.163  40.181  186.195 1.00 45.85 ? 332  GLU D OE1   1 
ATOM   3490 O  OE2   . GLU H 3 14 ? 43.192  41.183  188.161 1.00 44.17 ? 332  GLU D OE2   1 
ATOM   3491 N  N     . LYS H 3 15 ? 38.252  38.534  184.319 1.00 23.83 ? 333  LYS D N     1 
ATOM   3492 C  CA    . LYS H 3 15 ? 37.630  38.169  183.067 1.00 19.80 ? 333  LYS D CA    1 
ATOM   3493 C  C     . LYS H 3 15 ? 36.170  38.605  183.077 1.00 24.49 ? 333  LYS D C     1 
ATOM   3494 O  O     . LYS H 3 15 ? 35.654  39.047  182.064 1.00 33.59 ? 333  LYS D O     1 
ATOM   3495 C  CB    . LYS H 3 15 ? 37.723  36.690  182.804 1.00 21.56 ? 333  LYS D CB    1 
ATOM   3496 C  CG    . LYS H 3 15 ? 37.231  36.352  181.437 1.00 23.27 ? 333  LYS D CG    1 
ATOM   3497 C  CD    . LYS H 3 15 ? 37.505  34.924  181.122 1.00 23.22 ? 333  LYS D CD    1 
ATOM   3498 C  CE    . LYS H 3 15 ? 37.086  34.648  179.720 1.00 27.26 ? 333  LYS D CE    1 
ATOM   3499 N  NZ    . LYS H 3 15 ? 37.339  33.229  179.412 1.00 40.13 ? 333  LYS D NZ    1 
ATOM   3500 N  N     . ARG H 3 16 ? 35.508  38.506  184.228 1.00 33.04 ? 334  ARG D N     1 
ATOM   3501 C  CA    . ARG H 3 16 ? 34.107  38.914  184.370 1.00 31.25 ? 334  ARG D CA    1 
ATOM   3502 C  C     . ARG H 3 16 ? 34.064  40.362  183.941 1.00 29.77 ? 334  ARG D C     1 
ATOM   3503 O  O     . ARG H 3 16 ? 33.332  40.740  183.025 1.00 29.17 ? 334  ARG D O     1 
ATOM   3504 C  CB    . ARG H 3 16 ? 33.672  38.821  185.832 1.00 36.32 ? 334  ARG D CB    1 
ATOM   3505 C  CG    . ARG H 3 16 ? 32.215  39.255  186.100 1.00 51.12 ? 334  ARG D CG    1 
ATOM   3506 C  CD    . ARG H 3 16 ? 31.858  39.486  187.609 1.00 51.36 ? 334  ARG D CD    1 
ATOM   3507 N  NE    . ARG H 3 16 ? 32.542  38.571  188.531 1.00 53.37 ? 334  ARG D NE    1 
ATOM   3508 C  CZ    . ARG H 3 16 ? 32.624  37.243  188.387 1.00 61.02 ? 334  ARG D CZ    1 
ATOM   3509 N  NH1   . ARG H 3 16 ? 32.048  36.625  187.356 1.00 59.91 ? 334  ARG D NH1   1 
ATOM   3510 N  NH2   . ARG H 3 16 ? 33.365  36.532  189.233 1.00 56.52 ? 334  ARG D NH2   1 
ATOM   3511 N  N     . TYR H 3 17 ? 34.899  41.153  184.597 1.00 26.35 ? 335  TYR D N     1 
ATOM   3512 C  CA    . TYR H 3 17 ? 35.008  42.561  184.310 1.00 23.55 ? 335  TYR D CA    1 
ATOM   3513 C  C     . TYR H 3 17 ? 35.248  42.824  182.828 1.00 26.72 ? 335  TYR D C     1 
ATOM   3514 O  O     . TYR H 3 17 ? 34.512  43.580  182.193 1.00 29.10 ? 335  TYR D O     1 
ATOM   3515 C  CB    . TYR H 3 17 ? 36.143  43.167  185.111 1.00 18.97 ? 335  TYR D CB    1 
ATOM   3516 C  CG    . TYR H 3 17 ? 36.551  44.550  184.648 1.00 21.12 ? 335  TYR D CG    1 
ATOM   3517 C  CD1   . TYR H 3 17 ? 35.685  45.622  184.771 1.00 14.58 ? 335  TYR D CD1   1 
ATOM   3518 C  CD2   . TYR H 3 17 ? 37.803  44.784  184.104 1.00 17.35 ? 335  TYR D CD2   1 
ATOM   3519 C  CE1   . TYR H 3 17 ? 36.041  46.882  184.364 1.00 16.41 ? 335  TYR D CE1   1 
ATOM   3520 C  CE2   . TYR H 3 17 ? 38.176  46.060  183.699 1.00 14.72 ? 335  TYR D CE2   1 
ATOM   3521 C  CZ    . TYR H 3 17 ? 37.286  47.110  183.838 1.00 19.47 ? 335  TYR D CZ    1 
ATOM   3522 O  OH    . TYR H 3 17 ? 37.640  48.408  183.479 1.00 25.48 ? 335  TYR D OH    1 
ATOM   3523 N  N     . ARG H 3 18 ? 36.299  42.234  182.284 1.00 24.90 ? 336  ARG D N     1 
ATOM   3524 C  CA    . ARG H 3 18 ? 36.614  42.446  180.887 1.00 23.71 ? 336  ARG D CA    1 
ATOM   3525 C  C     . ARG H 3 18 ? 35.437  42.168  179.987 1.00 25.28 ? 336  ARG D C     1 
ATOM   3526 O  O     . ARG H 3 18 ? 35.176  42.934  179.061 1.00 29.94 ? 336  ARG D O     1 
ATOM   3527 C  CB    . ARG H 3 18 ? 37.814  41.616  180.482 1.00 22.34 ? 336  ARG D CB    1 
ATOM   3528 C  CG    . ARG H 3 18 ? 39.070  42.080  181.145 1.00 22.19 ? 336  ARG D CG    1 
ATOM   3529 C  CD    . ARG H 3 18 ? 40.243  41.478  180.451 1.00 21.51 ? 336  ARG D CD    1 
ATOM   3530 N  NE    . ARG H 3 18 ? 40.111  40.042  180.369 1.00 14.93 ? 336  ARG D NE    1 
ATOM   3531 C  CZ    . ARG H 3 18 ? 40.659  39.213  181.239 1.00 21.69 ? 336  ARG D CZ    1 
ATOM   3532 N  NH1   . ARG H 3 18 ? 41.376  39.695  182.241 1.00 21.33 ? 336  ARG D NH1   1 
ATOM   3533 N  NH2   . ARG H 3 18 ? 40.435  37.910  181.131 1.00 22.68 ? 336  ARG D NH2   1 
ATOM   3534 N  N     . SER H 3 19 ? 34.675  41.128  180.310 1.00 25.14 ? 337  SER D N     1 
ATOM   3535 C  CA    . SER H 3 19 ? 33.513  40.775  179.527 1.00 21.14 ? 337  SER D CA    1 
ATOM   3536 C  C     . SER H 3 19 ? 32.334  41.711  179.740 1.00 25.94 ? 337  SER D C     1 
ATOM   3537 O  O     . SER H 3 19 ? 31.450  41.817  178.884 1.00 28.87 ? 337  SER D O     1 
ATOM   3538 C  CB    . SER H 3 19 ? 33.115  39.358  179.827 1.00 26.04 ? 337  SER D CB    1 
ATOM   3539 O  OG    . SER H 3 19 ? 34.233  38.507  179.648 1.00 39.49 ? 337  SER D OG    1 
ATOM   3540 N  N     . SER H 3 20 ? 32.329  42.430  180.852 1.00 24.28 ? 338  SER D N     1 
ATOM   3541 C  CA    . SER H 3 20 ? 31.251  43.366  181.099 1.00 22.78 ? 338  SER D CA    1 
ATOM   3542 C  C     . SER H 3 20 ? 31.333  44.458  180.055 1.00 22.28 ? 338  SER D C     1 
ATOM   3543 O  O     . SER H 3 20 ? 30.366  45.132  179.754 1.00 21.19 ? 338  SER D O     1 
ATOM   3544 C  CB    . SER H 3 20 ? 31.369  43.968  182.511 1.00 22.56 ? 338  SER D CB    1 
ATOM   3545 O  OG    . SER H 3 20 ? 32.349  44.991  182.660 1.00 25.67 ? 338  SER D OG    1 
ATOM   3546 N  N     . ILE H 3 21 ? 32.545  44.666  179.573 1.00 24.95 ? 339  ILE D N     1 
ATOM   3547 C  CA    . ILE H 3 21 ? 32.845  45.675  178.583 1.00 22.73 ? 339  ILE D CA    1 
ATOM   3548 C  C     . ILE H 3 21 ? 32.744  45.100  177.169 1.00 24.15 ? 339  ILE D C     1 
ATOM   3549 O  O     . ILE H 3 21 ? 32.016  45.618  176.331 1.00 27.04 ? 339  ILE D O     1 
ATOM   3550 C  CB    . ILE H 3 21 ? 34.249  46.231  178.859 1.00 23.16 ? 339  ILE D CB    1 
ATOM   3551 C  CG1   . ILE H 3 21 ? 34.243  46.926  180.227 1.00 12.92 ? 339  ILE D CG1   1 
ATOM   3552 C  CG2   . ILE H 3 21 ? 34.688  47.201  177.768 1.00 18.35 ? 339  ILE D CG2   1 
ATOM   3553 C  CD1   . ILE H 3 21 ? 35.564  47.547  180.607 1.00 18.34 ? 339  ILE D CD1   1 
ATOM   3554 N  N     . ASN H 3 22 ? 33.380  43.959  176.948 1.00 25.61 ? 340  ASN D N     1 
ATOM   3555 C  CA    . ASN H 3 22 ? 33.383  43.333  175.647 1.00 20.42 ? 340  ASN D CA    1 
ATOM   3556 C  C     . ASN H 3 22 ? 32.028  42.924  175.166 1.00 26.10 ? 340  ASN D C     1 
ATOM   3557 O  O     . ASN H 3 22 ? 31.694  43.141  174.012 1.00 35.71 ? 340  ASN D O     1 
ATOM   3558 C  CB    . ASN H 3 22 ? 34.330  42.160  175.634 1.00 17.32 ? 340  ASN D CB    1 
ATOM   3559 C  CG    . ASN H 3 22 ? 35.754  42.589  175.831 1.00 23.83 ? 340  ASN D CG    1 
ATOM   3560 O  OD1   . ASN H 3 22 ? 36.152  43.708  175.436 1.00 24.10 ? 340  ASN D OD1   1 
ATOM   3561 N  ND2   . ASN H 3 22 ? 36.544  41.721  176.470 1.00 28.22 ? 340  ASN D ND2   1 
ATOM   3562 N  N     . ASP H 3 23 ? 31.236  42.341  176.050 1.00 31.41 ? 341  ASP D N     1 
ATOM   3563 C  CA    . ASP H 3 23 ? 29.888  41.920  175.714 1.00 26.74 ? 341  ASP D CA    1 
ATOM   3564 C  C     . ASP H 3 23 ? 29.105  43.106  175.212 1.00 25.21 ? 341  ASP D C     1 
ATOM   3565 O  O     . ASP H 3 23 ? 28.209  42.957  174.379 1.00 26.80 ? 341  ASP D O     1 
ATOM   3566 C  CB    . ASP H 3 23 ? 29.196  41.397  176.962 1.00 29.11 ? 341  ASP D CB    1 
ATOM   3567 C  CG    . ASP H 3 23 ? 29.651  40.016  177.344 1.00 36.31 ? 341  ASP D CG    1 
ATOM   3568 O  OD1   . ASP H 3 23 ? 30.496  39.433  176.612 1.00 42.87 ? 341  ASP D OD1   1 
ATOM   3569 O  OD2   . ASP H 3 23 ? 29.150  39.508  178.381 1.00 42.47 ? 341  ASP D OD2   1 
ATOM   3570 N  N     . LYS H 3 24 ? 29.445  44.284  175.734 1.00 20.26 ? 342  LYS D N     1 
ATOM   3571 C  CA    . LYS H 3 24 ? 28.762  45.511  175.379 1.00 21.77 ? 342  LYS D CA    1 
ATOM   3572 C  C     . LYS H 3 24 ? 29.234  46.100  174.077 1.00 25.92 ? 342  LYS D C     1 
ATOM   3573 O  O     . LYS H 3 24 ? 28.450  46.703  173.349 1.00 29.39 ? 342  LYS D O     1 
ATOM   3574 C  CB    . LYS H 3 24 ? 28.830  46.517  176.519 1.00 22.11 ? 342  LYS D CB    1 
ATOM   3575 C  CG    . LYS H 3 24 ? 27.821  46.218  177.593 1.00 20.44 ? 342  LYS D CG    1 
ATOM   3576 C  CD    . LYS H 3 24 ? 28.173  46.960  178.847 1.00 35.69 ? 342  LYS D CD    1 
ATOM   3577 C  CE    . LYS H 3 24 ? 27.453  46.374  180.057 1.00 35.75 ? 342  LYS D CE    1 
ATOM   3578 N  NZ    . LYS H 3 24 ? 27.847  44.963  180.341 1.00 36.51 ? 342  LYS D NZ    1 
ATOM   3579 N  N     . ILE H 3 25 ? 30.510  45.920  173.768 1.00 26.80 ? 343  ILE D N     1 
ATOM   3580 C  CA    . ILE H 3 25 ? 31.017  46.399  172.506 1.00 23.34 ? 343  ILE D CA    1 
ATOM   3581 C  C     . ILE H 3 25 ? 30.383  45.532  171.393 1.00 28.32 ? 343  ILE D C     1 
ATOM   3582 O  O     . ILE H 3 25 ? 30.013  46.048  170.338 1.00 31.12 ? 343  ILE D O     1 
ATOM   3583 C  CB    . ILE H 3 25 ? 32.515  46.354  172.479 1.00 19.66 ? 343  ILE D CB    1 
ATOM   3584 C  CG1   . ILE H 3 25 ? 33.045  47.367  173.484 1.00 16.40 ? 343  ILE D CG1   1 
ATOM   3585 C  CG2   . ILE H 3 25 ? 32.998  46.748  171.122 1.00 19.85 ? 343  ILE D CG2   1 
ATOM   3586 C  CD1   . ILE H 3 25 ? 34.554  47.438  173.562 1.00 15.37 ? 343  ILE D CD1   1 
ATOM   3587 N  N     . ILE H 3 26 ? 30.197  44.234  171.655 1.00 27.05 ? 344  ILE D N     1 
ATOM   3588 C  CA    . ILE H 3 26 ? 29.558  43.327  170.701 1.00 22.35 ? 344  ILE D CA    1 
ATOM   3589 C  C     . ILE H 3 26 ? 28.115  43.786  170.453 1.00 25.13 ? 344  ILE D C     1 
ATOM   3590 O  O     . ILE H 3 26 ? 27.609  43.692  169.344 1.00 28.34 ? 344  ILE D O     1 
ATOM   3591 C  CB    . ILE H 3 26 ? 29.554  41.880  171.232 1.00 25.64 ? 344  ILE D CB    1 
ATOM   3592 C  CG1   . ILE H 3 26 ? 30.968  41.315  171.223 1.00 22.19 ? 344  ILE D CG1   1 
ATOM   3593 C  CG2   . ILE H 3 26 ? 28.651  40.990  170.392 1.00 26.79 ? 344  ILE D CG2   1 
ATOM   3594 C  CD1   . ILE H 3 26 ? 31.112  40.071  172.041 1.00 24.22 ? 344  ILE D CD1   1 
ATOM   3595 N  N     . GLU H 3 27 ? 27.452  44.279  171.495 1.00 28.76 ? 345  GLU D N     1 
ATOM   3596 C  CA    . GLU H 3 27 ? 26.091  44.787  171.369 1.00 28.35 ? 345  GLU D CA    1 
ATOM   3597 C  C     . GLU H 3 27 ? 26.118  46.012  170.475 1.00 28.93 ? 345  GLU D C     1 
ATOM   3598 O  O     . GLU H 3 27 ? 25.282  46.162  169.603 1.00 29.03 ? 345  GLU D O     1 
ATOM   3599 C  CB    . GLU H 3 27 ? 25.521  45.169  172.723 1.00 32.01 ? 345  GLU D CB    1 
ATOM   3600 C  CG    . GLU H 3 27 ? 25.049  44.000  173.525 1.00 41.51 ? 345  GLU D CG    1 
ATOM   3601 C  CD    . GLU H 3 27 ? 24.164  44.411  174.712 1.00 51.52 ? 345  GLU D CD    1 
ATOM   3602 O  OE1   . GLU H 3 27 ? 22.983  44.801  174.503 1.00 45.20 ? 345  GLU D OE1   1 
ATOM   3603 O  OE2   . GLU H 3 27 ? 24.652  44.314  175.862 1.00 57.45 ? 345  GLU D OE2   1 
ATOM   3604 N  N     . LEU H 3 28 ? 27.073  46.905  170.702 1.00 29.47 ? 346  LEU D N     1 
ATOM   3605 C  CA    . LEU H 3 28 ? 27.187  48.096  169.874 1.00 25.38 ? 346  LEU D CA    1 
ATOM   3606 C  C     . LEU H 3 28 ? 27.527  47.687  168.452 1.00 27.45 ? 346  LEU D C     1 
ATOM   3607 O  O     . LEU H 3 28 ? 27.083  48.309  167.495 1.00 30.48 ? 346  LEU D O     1 
ATOM   3608 C  CB    . LEU H 3 28 ? 28.276  49.014  170.394 1.00 21.96 ? 346  LEU D CB    1 
ATOM   3609 C  CG    . LEU H 3 28 ? 27.921  49.915  171.561 1.00 24.37 ? 346  LEU D CG    1 
ATOM   3610 C  CD1   . LEU H 3 28 ? 29.157  50.692  172.018 1.00 21.17 ? 346  LEU D CD1   1 
ATOM   3611 C  CD2   . LEU H 3 28 ? 26.838  50.854  171.091 1.00 18.30 ? 346  LEU D CD2   1 
ATOM   3612 N  N     . LYS H 3 29 ? 28.304  46.623  168.315 1.00 29.72 ? 347  LYS D N     1 
ATOM   3613 C  CA    . LYS H 3 29 ? 28.689  46.170  167.002 1.00 29.06 ? 347  LYS D CA    1 
ATOM   3614 C  C     . LYS H 3 29 ? 27.467  45.743  166.216 1.00 27.38 ? 347  LYS D C     1 
ATOM   3615 O  O     . LYS H 3 29 ? 27.224  46.227  165.115 1.00 31.67 ? 347  LYS D O     1 
ATOM   3616 C  CB    . LYS H 3 29 ? 29.696  45.027  167.079 1.00 27.92 ? 347  LYS D CB    1 
ATOM   3617 C  CG    . LYS H 3 29 ? 30.049  44.551  165.712 1.00 24.95 ? 347  LYS D CG    1 
ATOM   3618 C  CD    . LYS H 3 29 ? 30.822  43.311  165.729 1.00 29.97 ? 347  LYS D CD    1 
ATOM   3619 C  CE    . LYS H 3 29 ? 30.574  42.547  164.451 1.00 31.86 ? 347  LYS D CE    1 
ATOM   3620 N  NZ    . LYS H 3 29 ? 29.313  41.771  164.543 1.00 29.48 ? 347  LYS D NZ    1 
ATOM   3621 N  N     . ASP H 3 30 ? 26.658  44.887  166.814 1.00 29.03 ? 348  ASP D N     1 
ATOM   3622 C  CA    . ASP H 3 30 ? 25.464  44.408  166.157 1.00 30.17 ? 348  ASP D CA    1 
ATOM   3623 C  C     . ASP H 3 30 ? 24.547  45.549  165.722 1.00 35.39 ? 348  ASP D C     1 
ATOM   3624 O  O     . ASP H 3 30 ? 23.770  45.390  164.784 1.00 44.91 ? 348  ASP D O     1 
ATOM   3625 C  CB    . ASP H 3 30 ? 24.716  43.441  167.058 1.00 31.80 ? 348  ASP D CB    1 
ATOM   3626 C  CG    . ASP H 3 30 ? 25.499  42.159  167.337 1.00 38.61 ? 348  ASP D CG    1 
ATOM   3627 O  OD1   . ASP H 3 30 ? 26.580  41.922  166.752 1.00 40.61 ? 348  ASP D OD1   1 
ATOM   3628 O  OD2   . ASP H 3 30 ? 25.003  41.363  168.158 1.00 47.52 ? 348  ASP D OD2   1 
ATOM   3629 N  N     . LEU H 3 31 ? 24.630  46.690  166.402 1.00 34.72 ? 349  LEU D N     1 
ATOM   3630 C  CA    . LEU H 3 31 ? 23.820  47.855  166.058 1.00 32.47 ? 349  LEU D CA    1 
ATOM   3631 C  C     . LEU H 3 31 ? 24.409  48.649  164.905 1.00 33.68 ? 349  LEU D C     1 
ATOM   3632 O  O     . LEU H 3 31 ? 23.680  49.270  164.158 1.00 38.86 ? 349  LEU D O     1 
ATOM   3633 C  CB    . LEU H 3 31 ? 23.675  48.842  167.233 1.00 30.10 ? 349  LEU D CB    1 
ATOM   3634 C  CG    . LEU H 3 31 ? 22.764  48.593  168.421 1.00 25.25 ? 349  LEU D CG    1 
ATOM   3635 C  CD1   . LEU H 3 31 ? 22.687  49.804  169.318 1.00 22.76 ? 349  LEU D CD1   1 
ATOM   3636 C  CD2   . LEU H 3 31 ? 21.433  48.270  167.893 1.00 25.61 ? 349  LEU D CD2   1 
ATOM   3637 N  N     . VAL H 3 32 ? 25.725  48.696  164.790 1.00 31.99 ? 350  VAL D N     1 
ATOM   3638 C  CA    . VAL H 3 32 ? 26.305  49.501  163.742 1.00 30.10 ? 350  VAL D CA    1 
ATOM   3639 C  C     . VAL H 3 32 ? 26.668  48.760  162.462 1.00 35.58 ? 350  VAL D C     1 
ATOM   3640 O  O     . VAL H 3 32 ? 26.596  49.330  161.366 1.00 39.53 ? 350  VAL D O     1 
ATOM   3641 C  CB    . VAL H 3 32 ? 27.513  50.347  164.259 1.00 26.70 ? 350  VAL D CB    1 
ATOM   3642 C  CG1   . VAL H 3 32 ? 27.043  51.328  165.308 1.00 14.89 ? 350  VAL D CG1   1 
ATOM   3643 C  CG2   . VAL H 3 32 ? 28.650  49.451  164.786 1.00 20.65 ? 350  VAL D CG2   1 
ATOM   3644 N  N     . VAL H 3 33 ? 27.071  47.502  162.583 1.00 35.51 ? 351  VAL D N     1 
ATOM   3645 C  CA    . VAL H 3 33 ? 27.447  46.751  161.402 1.00 30.65 ? 351  VAL D CA    1 
ATOM   3646 C  C     . VAL H 3 33 ? 26.747  45.416  161.337 1.00 31.94 ? 351  VAL D C     1 
ATOM   3647 O  O     . VAL H 3 33 ? 26.930  44.656  160.384 1.00 37.93 ? 351  VAL D O     1 
ATOM   3648 C  CB    . VAL H 3 33 ? 28.992  46.546  161.291 1.00 31.99 ? 351  VAL D CB    1 
ATOM   3649 C  CG1   . VAL H 3 33 ? 29.711  47.892  161.196 1.00 31.06 ? 351  VAL D CG1   1 
ATOM   3650 C  CG2   . VAL H 3 33 ? 29.518  45.725  162.462 1.00 28.06 ? 351  VAL D CG2   1 
ATOM   3651 N  N     . GLY H 3 34 ? 25.922  45.122  162.328 1.00 29.16 ? 352  GLY D N     1 
ATOM   3652 C  CA    . GLY H 3 34 ? 25.228  43.861  162.279 1.00 23.70 ? 352  GLY D CA    1 
ATOM   3653 C  C     . GLY H 3 34 ? 26.078  42.715  162.769 1.00 29.27 ? 352  GLY D C     1 
ATOM   3654 O  O     . GLY H 3 34 ? 27.244  42.852  163.132 1.00 32.97 ? 352  GLY D O     1 
ATOM   3655 N  N     . THR H 3 35 ? 25.457  41.557  162.730 1.00 32.75 ? 353  THR D N     1 
ATOM   3656 C  CA    . THR H 3 35 ? 25.992  40.300  163.198 1.00 29.60 ? 353  THR D CA    1 
ATOM   3657 C  C     . THR H 3 35 ? 27.002  39.513  162.361 1.00 29.20 ? 353  THR D C     1 
ATOM   3658 O  O     . THR H 3 35 ? 27.857  38.830  162.919 1.00 28.21 ? 353  THR D O     1 
ATOM   3659 C  CB    . THR H 3 35 ? 24.778  39.445  163.539 1.00 27.64 ? 353  THR D CB    1 
ATOM   3660 O  OG1   . THR H 3 35 ? 24.283  39.848  164.826 1.00 34.45 ? 353  THR D OG1   1 
ATOM   3661 C  CG2   . THR H 3 35 ? 25.066  38.010  163.485 1.00 32.79 ? 353  THR D CG2   1 
ATOM   3662 N  N     . GLU H 3 36 ? 26.900  39.568  161.038 1.00 32.57 ? 354  GLU D N     1 
ATOM   3663 C  CA    . GLU H 3 36 ? 27.810  38.794  160.201 1.00 30.81 ? 354  GLU D CA    1 
ATOM   3664 C  C     . GLU H 3 36 ? 29.191  39.381  160.093 1.00 30.73 ? 354  GLU D C     1 
ATOM   3665 O  O     . GLU H 3 36 ? 30.174  38.641  160.007 1.00 37.10 ? 354  GLU D O     1 
ATOM   3666 C  CB    . GLU H 3 36 ? 27.224  38.531  158.813 1.00 35.37 ? 354  GLU D CB    1 
ATOM   3667 C  CG    . GLU H 3 36 ? 26.193  37.405  158.802 1.00 47.33 ? 354  GLU D CG    1 
ATOM   3668 C  CD    . GLU H 3 36 ? 26.244  36.516  157.543 1.00 60.44 ? 354  GLU D CD    1 
ATOM   3669 O  OE1   . GLU H 3 36 ? 25.687  36.941  156.498 1.00 66.82 ? 354  GLU D OE1   1 
ATOM   3670 O  OE2   . GLU H 3 36 ? 26.813  35.388  157.609 1.00 52.93 ? 354  GLU D OE2   1 
ATOM   3671 N  N     . ALA H 3 37 ? 29.277  40.699  160.209 1.00 27.54 ? 355  ALA D N     1 
ATOM   3672 C  CA    . ALA H 3 37 ? 30.552  41.382  160.099 1.00 26.68 ? 355  ALA D CA    1 
ATOM   3673 C  C     . ALA H 3 37 ? 31.526  41.137  161.228 1.00 30.68 ? 355  ALA D C     1 
ATOM   3674 O  O     . ALA H 3 37 ? 31.221  40.520  162.248 1.00 32.96 ? 355  ALA D O     1 
ATOM   3675 C  CB    . ALA H 3 37 ? 30.341  42.880  159.924 1.00 23.73 ? 355  ALA D CB    1 
ATOM   3676 N  N     . LYS H 3 38 ? 32.737  41.610  160.996 1.00 31.17 ? 356  LYS D N     1 
ATOM   3677 C  CA    . LYS H 3 38 ? 33.806  41.520  161.950 1.00 26.43 ? 356  LYS D CA    1 
ATOM   3678 C  C     . LYS H 3 38 ? 34.348  42.912  161.891 1.00 29.77 ? 356  LYS D C     1 
ATOM   3679 O  O     . LYS H 3 38 ? 34.540  43.456  160.805 1.00 29.76 ? 356  LYS D O     1 
ATOM   3680 C  CB    . LYS H 3 38 ? 34.856  40.518  161.518 1.00 26.88 ? 356  LYS D CB    1 
ATOM   3681 C  CG    . LYS H 3 38 ? 34.553  39.130  162.038 1.00 37.25 ? 356  LYS D CG    1 
ATOM   3682 C  CD    . LYS H 3 38 ? 35.775  38.242  161.978 1.00 42.63 ? 356  LYS D CD    1 
ATOM   3683 C  CE    . LYS H 3 38 ? 35.732  37.156  163.042 1.00 51.71 ? 356  LYS D CE    1 
ATOM   3684 N  NZ    . LYS H 3 38 ? 36.026  37.677  164.420 1.00 59.76 ? 356  LYS D NZ    1 
ATOM   3685 N  N     . LEU H 3 39 ? 34.450  43.545  163.048 1.00 26.16 ? 357  LEU D N     1 
ATOM   3686 C  CA    . LEU H 3 39 ? 34.950  44.890  163.112 1.00 23.85 ? 357  LEU D CA    1 
ATOM   3687 C  C     . LEU H 3 39 ? 35.611  44.990  164.452 1.00 26.71 ? 357  LEU D C     1 
ATOM   3688 O  O     . LEU H 3 39 ? 35.091  44.512  165.445 1.00 32.95 ? 357  LEU D O     1 
ATOM   3689 C  CB    . LEU H 3 39 ? 33.798  45.861  163.007 1.00 26.22 ? 357  LEU D CB    1 
ATOM   3690 C  CG    . LEU H 3 39 ? 34.143  47.334  163.018 1.00 22.90 ? 357  LEU D CG    1 
ATOM   3691 C  CD1   . LEU H 3 39 ? 34.994  47.656  161.830 1.00 22.93 ? 357  LEU D CD1   1 
ATOM   3692 C  CD2   . LEU H 3 39 ? 32.848  48.097  162.947 1.00 22.48 ? 357  LEU D CD2   1 
ATOM   3693 N  N     . ASN H 3 40 ? 36.783  45.586  164.483 1.00 27.47 ? 358  ASN D N     1 
ATOM   3694 C  CA    . ASN H 3 40 ? 37.516  45.690  165.723 1.00 22.60 ? 358  ASN D CA    1 
ATOM   3695 C  C     . ASN H 3 40 ? 36.808  46.627  166.694 1.00 19.56 ? 358  ASN D C     1 
ATOM   3696 O  O     . ASN H 3 40 ? 36.106  47.540  166.293 1.00 28.99 ? 358  ASN D O     1 
ATOM   3697 C  CB    . ASN H 3 40 ? 38.954  46.137  165.419 1.00 21.01 ? 358  ASN D CB    1 
ATOM   3698 C  CG    . ASN H 3 40 ? 38.990  47.410  164.634 1.00 28.97 ? 358  ASN D CG    1 
ATOM   3699 O  OD1   . ASN H 3 40 ? 38.373  47.513  163.572 1.00 31.41 ? 358  ASN D OD1   1 
ATOM   3700 N  ND2   . ASN H 3 40 ? 39.627  48.428  165.190 1.00 35.19 ? 358  ASN D ND2   1 
ATOM   3701 N  N     . LYS H 3 41 ? 37.055  46.438  167.979 1.00 23.90 ? 359  LYS D N     1 
ATOM   3702 C  CA    . LYS H 3 41 ? 36.450  47.248  169.021 1.00 16.02 ? 359  LYS D CA    1 
ATOM   3703 C  C     . LYS H 3 41 ? 36.543  48.711  168.803 1.00 19.16 ? 359  LYS D C     1 
ATOM   3704 O  O     . LYS H 3 41 ? 35.532  49.376  168.853 1.00 26.66 ? 359  LYS D O     1 
ATOM   3705 C  CB    . LYS H 3 41 ? 37.071  46.946  170.372 1.00 17.38 ? 359  LYS D CB    1 
ATOM   3706 C  CG    . LYS H 3 41 ? 36.908  45.505  170.780 1.00 13.70 ? 359  LYS D CG    1 
ATOM   3707 C  CD    . LYS H 3 41 ? 37.663  45.226  172.047 1.00 14.77 ? 359  LYS D CD    1 
ATOM   3708 C  CE    . LYS H 3 41 ? 37.603  43.766  172.374 1.00 11.80 ? 359  LYS D CE    1 
ATOM   3709 N  NZ    . LYS H 3 41 ? 38.633  43.547  173.385 1.00 21.29 ? 359  LYS D NZ    1 
ATOM   3710 N  N     . SER H 3 42 ? 37.722  49.234  168.497 1.00 19.29 ? 360  SER D N     1 
ATOM   3711 C  CA    . SER H 3 42 ? 37.810  50.683  168.350 1.00 21.04 ? 360  SER D CA    1 
ATOM   3712 C  C     . SER H 3 42 ? 36.953  51.199  167.224 1.00 21.12 ? 360  SER D C     1 
ATOM   3713 O  O     . SER H 3 42 ? 36.418  52.310  167.286 1.00 26.08 ? 360  SER D O     1 
ATOM   3714 C  CB    . SER H 3 42 ? 39.258  51.164  168.228 1.00 21.40 ? 360  SER D CB    1 
ATOM   3715 O  OG    . SER H 3 42 ? 39.777  50.998  166.931 1.00 29.76 ? 360  SER D OG    1 
ATOM   3716 N  N     . ALA H 3 43 ? 36.735  50.359  166.225 1.00 24.44 ? 361  ALA D N     1 
ATOM   3717 C  CA    . ALA H 3 43 ? 35.928  50.772  165.079 1.00 24.40 ? 361  ALA D CA    1 
ATOM   3718 C  C     . ALA H 3 43 ? 34.438  50.695  165.402 1.00 20.21 ? 361  ALA D C     1 
ATOM   3719 O  O     . ALA H 3 43 ? 33.646  51.495  164.905 1.00 20.42 ? 361  ALA D O     1 
ATOM   3720 C  CB    . ALA H 3 43 ? 36.309  49.957  163.842 1.00 21.61 ? 361  ALA D CB    1 
ATOM   3721 N  N     . VAL H 3 44 ? 34.063  49.731  166.237 1.00 23.09 ? 362  VAL D N     1 
ATOM   3722 C  CA    . VAL H 3 44 ? 32.676  49.619  166.698 1.00 21.71 ? 362  VAL D CA    1 
ATOM   3723 C  C     . VAL H 3 44 ? 32.390  50.938  167.460 1.00 19.48 ? 362  VAL D C     1 
ATOM   3724 O  O     . VAL H 3 44 ? 31.472  51.647  167.150 1.00 24.98 ? 362  VAL D O     1 
ATOM   3725 C  CB    . VAL H 3 44 ? 32.517  48.408  167.671 1.00 26.31 ? 362  VAL D CB    1 
ATOM   3726 C  CG1   . VAL H 3 44 ? 31.180  48.445  168.394 1.00 25.80 ? 362  VAL D CG1   1 
ATOM   3727 C  CG2   . VAL H 3 44 ? 32.655  47.095  166.921 1.00 26.00 ? 362  VAL D CG2   1 
ATOM   3728 N  N     . LEU H 3 45 ? 33.255  51.301  168.399 1.00 23.38 ? 363  LEU D N     1 
ATOM   3729 C  CA    . LEU H 3 45 ? 33.104  52.515  169.183 1.00 15.90 ? 363  LEU D CA    1 
ATOM   3730 C  C     . LEU H 3 45 ? 33.065  53.740  168.317 1.00 23.82 ? 363  LEU D C     1 
ATOM   3731 O  O     . LEU H 3 45 ? 32.211  54.591  168.538 1.00 31.17 ? 363  LEU D O     1 
ATOM   3732 C  CB    . LEU H 3 45 ? 34.224  52.648  170.215 1.00 17.37 ? 363  LEU D CB    1 
ATOM   3733 C  CG    . LEU H 3 45 ? 34.340  51.454  171.156 1.00 16.03 ? 363  LEU D CG    1 
ATOM   3734 C  CD1   . LEU H 3 45 ? 35.517  51.620  172.028 1.00 15.28 ? 363  LEU D CD1   1 
ATOM   3735 C  CD2   . LEU H 3 45 ? 33.093  51.320  171.980 1.00 14.66 ? 363  LEU D CD2   1 
ATOM   3736 N  N     . ARG H 3 46 ? 34.018  53.887  167.389 1.00 25.76 ? 364  ARG D N     1 
ATOM   3737 C  CA    . ARG H 3 46 ? 34.039  55.028  166.461 1.00 19.85 ? 364  ARG D CA    1 
ATOM   3738 C  C     . ARG H 3 46 ? 32.692  55.154  165.714 1.00 22.82 ? 364  ARG D C     1 
ATOM   3739 O  O     . ARG H 3 46 ? 32.097  56.232  165.647 1.00 26.31 ? 364  ARG D O     1 
ATOM   3740 C  CB    . ARG H 3 46 ? 35.197  54.857  165.484 1.00 27.61 ? 364  ARG D CB    1 
ATOM   3741 C  CG    . ARG H 3 46 ? 35.215  55.764  164.249 1.00 28.13 ? 364  ARG D CG    1 
ATOM   3742 C  CD    . ARG H 3 46 ? 34.864  57.206  164.540 1.00 40.69 ? 364  ARG D CD    1 
ATOM   3743 N  NE    . ARG H 3 46 ? 35.600  57.755  165.670 1.00 51.95 ? 364  ARG D NE    1 
ATOM   3744 C  CZ    . ARG H 3 46 ? 35.175  58.751  166.442 1.00 47.15 ? 364  ARG D CZ    1 
ATOM   3745 N  NH1   . ARG H 3 46 ? 33.994  59.333  166.216 1.00 39.57 ? 364  ARG D NH1   1 
ATOM   3746 N  NH2   . ARG H 3 46 ? 35.952  59.160  167.439 1.00 44.11 ? 364  ARG D NH2   1 
ATOM   3747 N  N     . LYS H 3 47 ? 32.183  54.041  165.196 1.00 24.19 ? 365  LYS D N     1 
ATOM   3748 C  CA    . LYS H 3 47 ? 30.902  54.035  164.494 1.00 23.19 ? 365  LYS D CA    1 
ATOM   3749 C  C     . LYS H 3 47 ? 29.746  54.400  165.413 1.00 25.80 ? 365  LYS D C     1 
ATOM   3750 O  O     . LYS H 3 47 ? 28.876  55.186  165.055 1.00 31.38 ? 365  LYS D O     1 
ATOM   3751 C  CB    . LYS H 3 47 ? 30.644  52.659  163.905 1.00 24.15 ? 365  LYS D CB    1 
ATOM   3752 C  CG    . LYS H 3 47 ? 31.408  52.392  162.646 1.00 32.62 ? 365  LYS D CG    1 
ATOM   3753 C  CD    . LYS H 3 47 ? 31.213  50.957  162.162 1.00 38.44 ? 365  LYS D CD    1 
ATOM   3754 C  CE    . LYS H 3 47 ? 31.522  50.822  160.688 1.00 37.71 ? 365  LYS D CE    1 
ATOM   3755 N  NZ    . LYS H 3 47 ? 30.406  51.467  159.920 1.00 45.74 ? 365  LYS D NZ    1 
ATOM   3756 N  N     . ALA H 3 48 ? 29.722  53.802  166.596 1.00 24.86 ? 366  ALA D N     1 
ATOM   3757 C  CA    . ALA H 3 48 ? 28.665  54.064  167.546 1.00 25.67 ? 366  ALA D CA    1 
ATOM   3758 C  C     . ALA H 3 48 ? 28.682  55.537  167.878 1.00 24.65 ? 366  ALA D C     1 
ATOM   3759 O  O     . ALA H 3 48 ? 27.636  56.161  167.958 1.00 30.76 ? 366  ALA D O     1 
ATOM   3760 C  CB    . ALA H 3 48 ? 28.851  53.223  168.813 1.00 19.62 ? 366  ALA D CB    1 
ATOM   3761 N  N     . ILE H 3 49 ? 29.871  56.112  168.019 1.00 27.68 ? 367  ILE D N     1 
ATOM   3762 C  CA    . ILE H 3 49 ? 29.994  57.536  168.358 1.00 21.64 ? 367  ILE D CA    1 
ATOM   3763 C  C     . ILE H 3 49 ? 29.399  58.363  167.241 1.00 22.98 ? 367  ILE D C     1 
ATOM   3764 O  O     . ILE H 3 49 ? 28.544  59.223  167.477 1.00 29.40 ? 367  ILE D O     1 
ATOM   3765 C  CB    . ILE H 3 49 ? 31.481  57.961  168.573 1.00 21.12 ? 367  ILE D CB    1 
ATOM   3766 C  CG1   . ILE H 3 49 ? 32.035  57.344  169.849 1.00 17.44 ? 367  ILE D CG1   1 
ATOM   3767 C  CG2   . ILE H 3 49 ? 31.614  59.463  168.639 1.00 19.41 ? 367  ILE D CG2   1 
ATOM   3768 C  CD1   . ILE H 3 49 ? 33.458  57.655  170.064 1.00 18.65 ? 367  ILE D CD1   1 
ATOM   3769 N  N     . ASP H 3 50 ? 29.779  58.036  166.012 1.00 20.84 ? 368  ASP D N     1 
ATOM   3770 C  CA    . ASP H 3 50 ? 29.310  58.795  164.882 1.00 18.42 ? 368  ASP D CA    1 
ATOM   3771 C  C     . ASP H 3 50 ? 27.857  58.576  164.562 1.00 22.00 ? 368  ASP D C     1 
ATOM   3772 O  O     . ASP H 3 50 ? 27.172  59.487  164.080 1.00 23.03 ? 368  ASP D O     1 
ATOM   3773 C  CB    . ASP H 3 50 ? 30.208  58.555  163.683 1.00 29.21 ? 368  ASP D CB    1 
ATOM   3774 C  CG    . ASP H 3 50 ? 31.619  59.120  163.890 1.00 31.29 ? 368  ASP D CG    1 
ATOM   3775 O  OD1   . ASP H 3 50 ? 31.787  60.164  164.577 1.00 41.12 ? 368  ASP D OD1   1 
ATOM   3776 O  OD2   . ASP H 3 50 ? 32.560  58.518  163.340 1.00 41.25 ? 368  ASP D OD2   1 
ATOM   3777 N  N     . TYR H 3 51 ? 27.360  57.396  164.890 1.00 18.91 ? 369  TYR D N     1 
ATOM   3778 C  CA    . TYR H 3 51 ? 25.960  57.096  164.658 1.00 19.54 ? 369  TYR D CA    1 
ATOM   3779 C  C     . TYR H 3 51 ? 25.101  57.927  165.618 1.00 21.72 ? 369  TYR D C     1 
ATOM   3780 O  O     . TYR H 3 51 ? 24.118  58.514  165.225 1.00 31.96 ? 369  TYR D O     1 
ATOM   3781 C  CB    . TYR H 3 51 ? 25.721  55.614  164.871 1.00 18.50 ? 369  TYR D CB    1 
ATOM   3782 C  CG    . TYR H 3 51 ? 24.390  55.145  164.375 1.00 21.19 ? 369  TYR D CG    1 
ATOM   3783 C  CD1   . TYR H 3 51 ? 23.776  55.758  163.290 1.00 19.38 ? 369  TYR D CD1   1 
ATOM   3784 C  CD2   . TYR H 3 51 ? 23.745  54.084  164.988 1.00 20.17 ? 369  TYR D CD2   1 
ATOM   3785 C  CE1   . TYR H 3 51 ? 22.563  55.320  162.838 1.00 20.58 ? 369  TYR D CE1   1 
ATOM   3786 C  CE2   . TYR H 3 51 ? 22.531  53.639  164.548 1.00 19.52 ? 369  TYR D CE2   1 
ATOM   3787 C  CZ    . TYR H 3 51 ? 21.943  54.259  163.471 1.00 22.92 ? 369  TYR D CZ    1 
ATOM   3788 O  OH    . TYR H 3 51 ? 20.724  53.805  163.033 1.00 32.83 ? 369  TYR D OH    1 
ATOM   3789 N  N     . ILE H 3 52 ? 25.476  57.948  166.887 1.00 27.78 ? 370  ILE D N     1 
ATOM   3790 C  CA    . ILE H 3 52 ? 24.792  58.718  167.904 1.00 21.89 ? 370  ILE D CA    1 
ATOM   3791 C  C     . ILE H 3 52 ? 24.784  60.172  167.477 1.00 25.46 ? 370  ILE D C     1 
ATOM   3792 O  O     . ILE H 3 52 ? 23.737  60.818  167.516 1.00 32.34 ? 370  ILE D O     1 
ATOM   3793 C  CB    . ILE H 3 52 ? 25.513  58.594  169.267 1.00 21.82 ? 370  ILE D CB    1 
ATOM   3794 C  CG1   . ILE H 3 52 ? 25.246  57.215  169.862 1.00 23.10 ? 370  ILE D CG1   1 
ATOM   3795 C  CG2   . ILE H 3 52 ? 25.040  59.654  170.230 1.00 22.75 ? 370  ILE D CG2   1 
ATOM   3796 C  CD1   . ILE H 3 52 ? 26.156  56.873  171.020 1.00 20.48 ? 370  ILE D CD1   1 
ATOM   3797 N  N     . ARG H 3 53 ? 25.932  60.709  167.077 1.00 21.71 ? 371  ARG D N     1 
ATOM   3798 C  CA    . ARG H 3 53 ? 25.960  62.102  166.651 1.00 19.53 ? 371  ARG D CA    1 
ATOM   3799 C  C     . ARG H 3 53 ? 25.119  62.327  165.423 1.00 21.57 ? 371  ARG D C     1 
ATOM   3800 O  O     . ARG H 3 53 ? 24.427  63.311  165.327 1.00 27.84 ? 371  ARG D O     1 
ATOM   3801 C  CB    . ARG H 3 53 ? 27.363  62.552  166.390 1.00 19.46 ? 371  ARG D CB    1 
ATOM   3802 C  CG    . ARG H 3 53 ? 28.219  62.520  167.604 1.00 22.15 ? 371  ARG D CG    1 
ATOM   3803 C  CD    . ARG H 3 53 ? 29.567  63.066  167.289 1.00 27.29 ? 371  ARG D CD    1 
ATOM   3804 N  NE    . ARG H 3 53 ? 30.394  63.073  168.478 1.00 29.74 ? 371  ARG D NE    1 
ATOM   3805 C  CZ    . ARG H 3 53 ? 31.671  62.730  168.490 1.00 34.35 ? 371  ARG D CZ    1 
ATOM   3806 N  NH1   . ARG H 3 53 ? 32.267  62.347  167.353 1.00 39.71 ? 371  ARG D NH1   1 
ATOM   3807 N  NH2   . ARG H 3 53 ? 32.339  62.735  169.641 1.00 34.41 ? 371  ARG D NH2   1 
ATOM   3808 N  N     . PHE H 3 54 ? 25.169  61.401  164.484 1.00 25.73 ? 372  PHE D N     1 
ATOM   3809 C  CA    . PHE H 3 54 ? 24.370  61.479  163.260 1.00 25.43 ? 372  PHE D CA    1 
ATOM   3810 C  C     . PHE H 3 54 ? 22.854  61.492  163.576 1.00 26.23 ? 372  PHE D C     1 
ATOM   3811 O  O     . PHE H 3 54 ? 22.091  62.272  163.011 1.00 32.33 ? 372  PHE D O     1 
ATOM   3812 C  CB    . PHE H 3 54 ? 24.719  60.292  162.364 1.00 25.61 ? 372  PHE D CB    1 
ATOM   3813 C  CG    . PHE H 3 54 ? 23.747  60.071  161.278 1.00 27.78 ? 372  PHE D CG    1 
ATOM   3814 C  CD1   . PHE H 3 54 ? 23.814  60.810  160.122 1.00 29.81 ? 372  PHE D CD1   1 
ATOM   3815 C  CD2   . PHE H 3 54 ? 22.711  59.177  161.442 1.00 33.29 ? 372  PHE D CD2   1 
ATOM   3816 C  CE1   . PHE H 3 54 ? 22.857  60.678  159.149 1.00 31.08 ? 372  PHE D CE1   1 
ATOM   3817 C  CE2   . PHE H 3 54 ? 21.747  59.036  160.475 1.00 35.29 ? 372  PHE D CE2   1 
ATOM   3818 C  CZ    . PHE H 3 54 ? 21.820  59.792  159.328 1.00 33.92 ? 372  PHE D CZ    1 
ATOM   3819 N  N     . LEU H 3 55 ? 22.417  60.595  164.446 1.00 26.51 ? 373  LEU D N     1 
ATOM   3820 C  CA    . LEU H 3 55 ? 21.021  60.527  164.871 1.00 24.97 ? 373  LEU D CA    1 
ATOM   3821 C  C     . LEU H 3 55 ? 20.645  61.783  165.661 1.00 24.21 ? 373  LEU D C     1 
ATOM   3822 O  O     . LEU H 3 55 ? 19.553  62.305  165.529 1.00 27.80 ? 373  LEU D O     1 
ATOM   3823 C  CB    . LEU H 3 55 ? 20.819  59.301  165.751 1.00 20.45 ? 373  LEU D CB    1 
ATOM   3824 C  CG    . LEU H 3 55 ? 20.828  57.955  165.036 1.00 18.18 ? 373  LEU D CG    1 
ATOM   3825 C  CD1   . LEU H 3 55 ? 20.940  56.827  166.031 1.00 15.15 ? 373  LEU D CD1   1 
ATOM   3826 C  CD2   . LEU H 3 55 ? 19.572  57.830  164.221 1.00 17.04 ? 373  LEU D CD2   1 
ATOM   3827 N  N     . GLN H 3 56 ? 21.554  62.257  166.498 1.00 25.45 ? 374  GLN D N     1 
ATOM   3828 C  CA    . GLN H 3 56 ? 21.309  63.450  167.280 1.00 21.02 ? 374  GLN D CA    1 
ATOM   3829 C  C     . GLN H 3 56 ? 21.012  64.591  166.355 1.00 25.84 ? 374  GLN D C     1 
ATOM   3830 O  O     . GLN H 3 56 ? 20.008  65.255  166.515 1.00 35.24 ? 374  GLN D O     1 
ATOM   3831 C  CB    . GLN H 3 56 ? 22.495  63.781  168.168 1.00 17.21 ? 374  GLN D CB    1 
ATOM   3832 C  CG    . GLN H 3 56 ? 22.451  63.062  169.471 1.00 17.75 ? 374  GLN D CG    1 
ATOM   3833 C  CD    . GLN H 3 56 ? 23.683  63.292  170.345 1.00 23.91 ? 374  GLN D CD    1 
ATOM   3834 O  OE1   . GLN H 3 56 ? 24.739  63.737  169.875 1.00 27.41 ? 374  GLN D OE1   1 
ATOM   3835 N  NE2   . GLN H 3 56 ? 23.559  62.955  171.625 1.00 23.47 ? 374  GLN D NE2   1 
ATOM   3836 N  N     . HIS H 3 57 ? 21.836  64.800  165.345 1.00 30.98 ? 375  HIS D N     1 
ATOM   3837 C  CA    . HIS H 3 57 ? 21.570  65.884  164.419 1.00 33.85 ? 375  HIS D CA    1 
ATOM   3838 C  C     . HIS H 3 57 ? 20.379  65.624  163.516 1.00 36.20 ? 375  HIS D C     1 
ATOM   3839 O  O     . HIS H 3 57 ? 19.589  66.519  163.247 1.00 40.29 ? 375  HIS D O     1 
ATOM   3840 C  CB    . HIS H 3 57 ? 22.822  66.235  163.639 1.00 36.47 ? 375  HIS D CB    1 
ATOM   3841 C  CG    . HIS H 3 57 ? 23.878  66.841  164.507 1.00 61.10 ? 375  HIS D CG    1 
ATOM   3842 N  ND1   . HIS H 3 57 ? 25.229  66.745  164.235 1.00 64.91 ? 375  HIS D ND1   1 
ATOM   3843 C  CD2   . HIS H 3 57 ? 23.774  67.509  165.685 1.00 61.20 ? 375  HIS D CD2   1 
ATOM   3844 C  CE1   . HIS H 3 57 ? 25.912  67.326  165.209 1.00 68.94 ? 375  HIS D CE1   1 
ATOM   3845 N  NE2   . HIS H 3 57 ? 25.054  67.797  166.100 1.00 71.40 ? 375  HIS D NE2   1 
ATOM   3846 N  N     . SER H 3 58 ? 20.214  64.388  163.083 1.00 35.48 ? 376  SER D N     1 
ATOM   3847 C  CA    . SER H 3 58 ? 19.100  64.061  162.231 1.00 35.21 ? 376  SER D CA    1 
ATOM   3848 C  C     . SER H 3 58 ? 17.835  64.406  162.972 1.00 31.42 ? 376  SER D C     1 
ATOM   3849 O  O     . SER H 3 58 ? 16.987  65.110  162.447 1.00 36.40 ? 376  SER D O     1 
ATOM   3850 C  CB    . SER H 3 58 ? 19.134  62.570  161.879 1.00 41.30 ? 376  SER D CB    1 
ATOM   3851 O  OG    . SER H 3 58 ? 18.137  62.207  160.925 1.00 52.44 ? 376  SER D OG    1 
ATOM   3852 N  N     . ASN H 3 59 ? 17.744  63.954  164.220 1.00 36.36 ? 377  ASN D N     1 
ATOM   3853 C  CA    . ASN H 3 59 ? 16.570  64.181  165.075 1.00 31.81 ? 377  ASN D CA    1 
ATOM   3854 C  C     . ASN H 3 59 ? 16.303  65.648  165.385 1.00 29.56 ? 377  ASN D C     1 
ATOM   3855 O  O     . ASN H 3 59 ? 15.162  66.079  165.385 1.00 33.03 ? 377  ASN D O     1 
ATOM   3856 C  CB    . ASN H 3 59 ? 16.672  63.386  166.382 1.00 29.29 ? 377  ASN D CB    1 
ATOM   3857 C  CG    . ASN H 3 59 ? 16.557  61.880  166.181 1.00 28.51 ? 377  ASN D CG    1 
ATOM   3858 O  OD1   . ASN H 3 59 ? 16.190  61.403  165.125 1.00 31.66 ? 377  ASN D OD1   1 
ATOM   3859 N  ND2   . ASN H 3 59 ? 16.862  61.130  167.217 1.00 30.82 ? 377  ASN D ND2   1 
ATOM   3860 N  N     . GLN H 3 60 ? 17.354  66.410  165.655 1.00 31.63 ? 378  GLN D N     1 
ATOM   3861 C  CA    . GLN H 3 60 ? 17.256  67.843  165.953 1.00 37.42 ? 378  GLN D CA    1 
ATOM   3862 C  C     . GLN H 3 60 ? 16.726  68.614  164.733 1.00 39.63 ? 378  GLN D C     1 
ATOM   3863 O  O     . GLN H 3 60 ? 15.888  69.518  164.855 1.00 41.58 ? 378  GLN D O     1 
ATOM   3864 C  CB    . GLN H 3 60 ? 18.636  68.370  166.320 1.00 38.69 ? 378  GLN D CB    1 
ATOM   3865 C  CG    . GLN H 3 60 ? 18.640  69.751  166.954 1.00 54.07 ? 378  GLN D CG    1 
ATOM   3866 C  CD    . GLN H 3 60 ? 20.059  70.347  167.065 1.00 68.02 ? 378  GLN D CD    1 
ATOM   3867 O  OE1   . GLN H 3 60 ? 21.045  69.815  166.486 1.00 67.01 ? 378  GLN D OE1   1 
ATOM   3868 N  NE2   . GLN H 3 60 ? 20.168  71.462  167.802 1.00 64.98 ? 378  GLN D NE2   1 
ATOM   3869 N  N     . LYS H 3 61 ? 17.226  68.235  163.562 1.00 38.28 ? 379  LYS D N     1 
ATOM   3870 C  CA    . LYS H 3 61 ? 16.828  68.822  162.301 1.00 34.78 ? 379  LYS D CA    1 
ATOM   3871 C  C     . LYS H 3 61 ? 15.367  68.522  162.031 1.00 35.40 ? 379  LYS D C     1 
ATOM   3872 O  O     . LYS H 3 61 ? 14.625  69.409  161.623 1.00 43.85 ? 379  LYS D O     1 
ATOM   3873 C  CB    . LYS H 3 61 ? 17.694  68.274  161.183 1.00 35.52 ? 379  LYS D CB    1 
ATOM   3874 C  CG    . LYS H 3 61 ? 18.494  69.333  160.490 1.00 43.97 ? 379  LYS D CG    1 
ATOM   3875 C  CD    . LYS H 3 61 ? 17.699  69.955  159.324 1.00 61.89 ? 379  LYS D CD    1 
ATOM   3876 C  CE    . LYS H 3 61 ? 17.744  71.514  159.297 1.00 67.15 ? 379  LYS D CE    1 
ATOM   3877 N  NZ    . LYS H 3 61 ? 16.890  72.195  160.352 1.00 63.57 ? 379  LYS D NZ    1 
ATOM   3878 N  N     . LEU H 3 62 ? 14.941  67.284  162.263 1.00 32.80 ? 380  LEU D N     1 
ATOM   3879 C  CA    . LEU H 3 62 ? 13.539  66.917  162.056 1.00 30.45 ? 380  LEU D CA    1 
ATOM   3880 C  C     . LEU H 3 62 ? 12.675  67.667  163.034 1.00 34.60 ? 380  LEU D C     1 
ATOM   3881 O  O     . LEU H 3 62 ? 11.511  67.963  162.755 1.00 38.85 ? 380  LEU D O     1 
ATOM   3882 C  CB    . LEU H 3 62 ? 13.313  65.430  162.279 1.00 25.68 ? 380  LEU D CB    1 
ATOM   3883 C  CG    . LEU H 3 62 ? 13.674  64.569  161.089 1.00 21.89 ? 380  LEU D CG    1 
ATOM   3884 C  CD1   . LEU H 3 62 ? 14.274  63.272  161.557 1.00 20.76 ? 380  LEU D CD1   1 
ATOM   3885 C  CD2   . LEU H 3 62 ? 12.453  64.369  160.219 1.00 22.86 ? 380  LEU D CD2   1 
ATOM   3886 N  N     . LYS H 3 63 ? 13.229  67.939  164.204 1.00 33.95 ? 381  LYS D N     1 
ATOM   3887 C  CA    . LYS H 3 63 ? 12.494  68.658  165.219 1.00 37.01 ? 381  LYS D CA    1 
ATOM   3888 C  C     . LYS H 3 63 ? 12.322  70.115  164.799 1.00 39.01 ? 381  LYS D C     1 
ATOM   3889 O  O     . LYS H 3 63 ? 11.229  70.678  164.923 1.00 40.33 ? 381  LYS D O     1 
ATOM   3890 C  CB    . LYS H 3 63 ? 13.202  68.548  166.562 1.00 35.62 ? 381  LYS D CB    1 
ATOM   3891 C  CG    . LYS H 3 63 ? 12.938  67.258  167.281 1.00 35.23 ? 381  LYS D CG    1 
ATOM   3892 C  CD    . LYS H 3 63 ? 13.810  67.197  168.502 1.00 40.04 ? 381  LYS D CD    1 
ATOM   3893 C  CE    . LYS H 3 63 ? 13.540  65.980  169.311 1.00 40.81 ? 381  LYS D CE    1 
ATOM   3894 N  NZ    . LYS H 3 63 ? 14.354  66.077  170.533 1.00 51.52 ? 381  LYS D NZ    1 
ATOM   3895 N  N     . GLN H 3 64 ? 13.393  70.712  164.289 1.00 35.64 ? 382  GLN D N     1 
ATOM   3896 C  CA    . GLN H 3 64 ? 13.359  72.087  163.825 1.00 37.47 ? 382  GLN D CA    1 
ATOM   3897 C  C     . GLN H 3 64 ? 12.303  72.215  162.732 1.00 39.88 ? 382  GLN D C     1 
ATOM   3898 O  O     . GLN H 3 64 ? 11.419  73.069  162.778 1.00 41.70 ? 382  GLN D O     1 
ATOM   3899 C  CB    . GLN H 3 64 ? 14.732  72.451  163.278 1.00 39.86 ? 382  GLN D CB    1 
ATOM   3900 C  CG    . GLN H 3 64 ? 15.582  73.303  164.220 1.00 54.22 ? 382  GLN D CG    1 
ATOM   3901 C  CD    . GLN H 3 64 ? 15.626  72.792  165.675 1.00 68.16 ? 382  GLN D CD    1 
ATOM   3902 O  OE1   . GLN H 3 64 ? 16.642  72.239  166.127 1.00 74.70 ? 382  GLN D OE1   1 
ATOM   3903 N  NE2   . GLN H 3 64 ? 14.537  73.021  166.428 1.00 72.31 ? 382  GLN D NE2   1 
ATOM   3904 N  N     . GLU H 3 65 ? 12.383  71.288  161.789 1.00 41.04 ? 383  GLU D N     1 
ATOM   3905 C  CA    . GLU H 3 65 ? 11.501  71.188  160.639 1.00 33.97 ? 383  GLU D CA    1 
ATOM   3906 C  C     . GLU H 3 65 ? 10.078  71.032  161.091 1.00 31.07 ? 383  GLU D C     1 
ATOM   3907 O  O     . GLU H 3 65 ? 9.203   71.752  160.629 1.00 34.15 ? 383  GLU D O     1 
ATOM   3908 C  CB    . GLU H 3 65 ? 11.915  69.961  159.830 1.00 39.83 ? 383  GLU D CB    1 
ATOM   3909 C  CG    . GLU H 3 65 ? 11.596  70.008  158.367 1.00 45.57 ? 383  GLU D CG    1 
ATOM   3910 C  CD    . GLU H 3 65 ? 12.341  68.940  157.602 1.00 52.14 ? 383  GLU D CD    1 
ATOM   3911 O  OE1   . GLU H 3 65 ? 13.563  69.114  157.364 1.00 53.24 ? 383  GLU D OE1   1 
ATOM   3912 O  OE2   . GLU H 3 65 ? 11.708  67.919  157.252 1.00 58.84 ? 383  GLU D OE2   1 
ATOM   3913 N  N     . ASN H 3 66 ? 9.852   70.066  161.975 1.00 33.32 ? 384  ASN D N     1 
ATOM   3914 C  CA    . ASN H 3 66 ? 8.521   69.787  162.512 1.00 35.79 ? 384  ASN D CA    1 
ATOM   3915 C  C     . ASN H 3 66 ? 7.916   70.967  163.248 1.00 37.88 ? 384  ASN D C     1 
ATOM   3916 O  O     . ASN H 3 66 ? 6.694   71.071  163.380 1.00 38.21 ? 384  ASN D O     1 
ATOM   3917 C  CB    . ASN H 3 66 ? 8.541   68.586  163.445 1.00 29.49 ? 384  ASN D CB    1 
ATOM   3918 C  CG    . ASN H 3 66 ? 8.757   67.312  162.728 1.00 26.16 ? 384  ASN D CG    1 
ATOM   3919 O  OD1   . ASN H 3 66 ? 8.924   67.306  161.523 1.00 33.21 ? 384  ASN D OD1   1 
ATOM   3920 N  ND2   . ASN H 3 66 ? 8.757   66.211  163.454 1.00 23.90 ? 384  ASN D ND2   1 
ATOM   3921 N  N     . LEU H 3 67 ? 8.776   71.833  163.760 1.00 39.62 ? 385  LEU D N     1 
ATOM   3922 C  CA    . LEU H 3 67 ? 8.328   73.017  164.470 1.00 46.86 ? 385  LEU D CA    1 
ATOM   3923 C  C     . LEU H 3 67 ? 7.668   73.927  163.448 1.00 50.29 ? 385  LEU D C     1 
ATOM   3924 O  O     . LEU H 3 67 ? 6.480   74.262  163.562 1.00 52.36 ? 385  LEU D O     1 
ATOM   3925 C  CB    . LEU H 3 67 ? 9.531   73.725  165.076 1.00 54.22 ? 385  LEU D CB    1 
ATOM   3926 C  CG    . LEU H 3 67 ? 9.320   74.752  166.180 1.00 55.20 ? 385  LEU D CG    1 
ATOM   3927 C  CD1   . LEU H 3 67 ? 8.546   74.142  167.342 1.00 53.25 ? 385  LEU D CD1   1 
ATOM   3928 C  CD2   . LEU H 3 67 ? 10.699  75.220  166.616 1.00 59.75 ? 385  LEU D CD2   1 
ATOM   3929 N  N     . SER H 3 68 ? 8.450   74.301  162.438 1.00 48.64 ? 386  SER D N     1 
ATOM   3930 C  CA    . SER H 3 68 ? 7.982   75.146  161.355 1.00 47.47 ? 386  SER D CA    1 
ATOM   3931 C  C     . SER H 3 68 ? 6.750   74.542  160.753 1.00 45.19 ? 386  SER D C     1 
ATOM   3932 O  O     . SER H 3 68 ? 5.702   75.160  160.751 1.00 49.53 ? 386  SER D O     1 
ATOM   3933 C  CB    . SER H 3 68 ? 9.041   75.236  160.286 1.00 47.50 ? 386  SER D CB    1 
ATOM   3934 O  OG    . SER H 3 68 ? 10.279  75.493  160.908 1.00 62.71 ? 386  SER D OG    1 
ATOM   3935 N  N     . LEU H 3 69 ? 6.857   73.313  160.281 1.00 44.31 ? 387  LEU D N     1 
ATOM   3936 C  CA    . LEU H 3 69 ? 5.706   72.663  159.678 1.00 46.67 ? 387  LEU D CA    1 
ATOM   3937 C  C     . LEU H 3 69 ? 4.475   72.782  160.560 1.00 48.93 ? 387  LEU D C     1 
ATOM   3938 O  O     . LEU H 3 69 ? 3.372   73.012  160.074 1.00 51.06 ? 387  LEU D O     1 
ATOM   3939 C  CB    . LEU H 3 69 ? 6.004   71.194  159.412 1.00 41.45 ? 387  LEU D CB    1 
ATOM   3940 C  CG    . LEU H 3 69 ? 6.809   70.902  158.166 1.00 34.96 ? 387  LEU D CG    1 
ATOM   3941 C  CD1   . LEU H 3 69 ? 7.275   69.470  158.143 1.00 30.29 ? 387  LEU D CD1   1 
ATOM   3942 C  CD2   . LEU H 3 69 ? 5.919   71.199  156.994 1.00 39.44 ? 387  LEU D CD2   1 
ATOM   3943 N  N     . ARG H 3 70 ? 4.678   72.674  161.863 1.00 50.05 ? 388  ARG D N     1 
ATOM   3944 C  CA    . ARG H 3 70 ? 3.576   72.737  162.806 1.00 51.06 ? 388  ARG D CA    1 
ATOM   3945 C  C     . ARG H 3 70 ? 3.017   74.147  162.885 1.00 50.72 ? 388  ARG D C     1 
ATOM   3946 O  O     . ARG H 3 70 ? 1.801   74.365  162.872 1.00 56.79 ? 388  ARG D O     1 
ATOM   3947 C  CB    . ARG H 3 70 ? 4.043   72.264  164.181 1.00 48.22 ? 388  ARG D CB    1 
ATOM   3948 C  CG    . ARG H 3 70 ? 3.075   71.305  164.815 1.00 49.55 ? 388  ARG D CG    1 
ATOM   3949 C  CD    . ARG H 3 70 ? 3.556   70.802  166.156 1.00 46.24 ? 388  ARG D CD    1 
ATOM   3950 N  NE    . ARG H 3 70 ? 4.395   69.620  166.034 1.00 45.16 ? 388  ARG D NE    1 
ATOM   3951 C  CZ    . ARG H 3 70 ? 5.700   69.611  166.291 1.00 44.71 ? 388  ARG D CZ    1 
ATOM   3952 N  NH1   . ARG H 3 70 ? 6.330   70.723  166.678 1.00 35.69 ? 388  ARG D NH1   1 
ATOM   3953 N  NH2   . ARG H 3 70 ? 6.368   68.472  166.214 1.00 40.07 ? 388  ARG D NH2   1 
ATOM   3954 N  N     . THR H 3 71 ? 3.921   75.107  162.916 1.00 52.01 ? 389  THR D N     1 
ATOM   3955 C  CA    . THR H 3 71 ? 3.561   76.502  162.990 1.00 51.55 ? 389  THR D CA    1 
ATOM   3956 C  C     . THR H 3 71 ? 2.974   76.980  161.664 1.00 52.68 ? 389  THR D C     1 
ATOM   3957 O  O     . THR H 3 71 ? 2.074   77.820  161.638 1.00 52.95 ? 389  THR D O     1 
ATOM   3958 C  CB    . THR H 3 71 ? 4.788   77.290  163.387 1.00 50.82 ? 389  THR D CB    1 
ATOM   3959 O  OG1   . THR H 3 71 ? 5.206   76.845  164.687 1.00 64.97 ? 389  THR D OG1   1 
ATOM   3960 C  CG2   . THR H 3 71 ? 4.498   78.768  163.422 1.00 57.06 ? 389  THR D CG2   1 
ATOM   3961 N  N     . ALA H 3 72 ? 3.446   76.394  160.571 1.00 53.19 ? 390  ALA D N     1 
ATOM   3962 C  CA    . ALA H 3 72 ? 2.957   76.728  159.246 1.00 52.73 ? 390  ALA D CA    1 
ATOM   3963 C  C     . ALA H 3 72 ? 1.501   76.335  159.270 1.00 50.78 ? 390  ALA D C     1 
ATOM   3964 O  O     . ALA H 3 72 ? 0.635   77.115  158.901 1.00 54.74 ? 390  ALA D O     1 
ATOM   3965 C  CB    . ALA H 3 72 ? 3.693   75.926  158.194 1.00 50.91 ? 390  ALA D CB    1 
ATOM   3966 N  N     . VAL H 3 73 ? 1.250   75.124  159.755 1.00 52.76 ? 391  VAL D N     1 
ATOM   3967 C  CA    . VAL H 3 73 ? -0.098  74.581  159.889 1.00 52.26 ? 391  VAL D CA    1 
ATOM   3968 C  C     . VAL H 3 73 ? -0.937  75.641  160.580 1.00 53.18 ? 391  VAL D C     1 
ATOM   3969 O  O     . VAL H 3 73 ? -1.991  76.023  160.082 1.00 55.34 ? 391  VAL D O     1 
ATOM   3970 C  CB    . VAL H 3 73 ? -0.087  73.266  160.721 1.00 49.76 ? 391  VAL D CB    1 
ATOM   3971 C  CG1   . VAL H 3 73 ? -1.458  72.949  161.236 1.00 51.76 ? 391  VAL D CG1   1 
ATOM   3972 C  CG2   . VAL H 3 73 ? 0.429   72.100  159.871 1.00 48.36 ? 391  VAL D CG2   1 
ATOM   3973 N  N     . HIS H 3 74 ? -0.414  76.161  161.687 1.00 56.56 ? 392  HIS D N     1 
ATOM   3974 C  CA    . HIS H 3 74 ? -1.091  77.208  162.454 1.00 58.90 ? 392  HIS D CA    1 
ATOM   3975 C  C     . HIS H 3 74 ? -1.386  78.398  161.550 1.00 57.69 ? 392  HIS D C     1 
ATOM   3976 O  O     . HIS H 3 74 ? -2.534  78.817  161.407 1.00 56.48 ? 392  HIS D O     1 
ATOM   3977 C  CB    . HIS H 3 74 ? -0.212  77.659  163.633 1.00 52.97 ? 392  HIS D CB    1 
ATOM   3978 N  N     . LYS H 3 75 ? -0.330  78.933  160.949 1.00 57.33 ? 393  LYS D N     1 
ATOM   3979 C  CA    . LYS H 3 75 ? -0.426  80.078  160.059 1.00 54.37 ? 393  LYS D CA    1 
ATOM   3980 C  C     . LYS H 3 75 ? -0.996  79.618  158.718 1.00 56.40 ? 393  LYS D C     1 
ATOM   3981 O  O     . LYS H 3 75 ? -0.417  79.833  157.645 1.00 62.77 ? 393  LYS D O     1 
ATOM   3982 C  CB    . LYS H 3 75 ? 0.951   80.718  159.891 1.00 55.56 ? 393  LYS D CB    1 
ATOM   3983 N  N     . SER H 3 76 ? -2.149  78.976  158.807 1.00 55.90 ? 394  SER D N     1 
ATOM   3984 C  CA    . SER H 3 76 ? -2.867  78.451  157.663 1.00 57.45 ? 394  SER D CA    1 
ATOM   3985 C  C     . SER H 3 76 ? -4.203  77.948  158.215 1.00 60.98 ? 394  SER D C     1 
ATOM   3986 O  O     . SER H 3 76 ? -4.556  78.395  159.343 1.00 62.55 ? 394  SER D O     1 
ATOM   3987 C  CB    . SER H 3 76 ? -2.085  77.301  157.021 1.00 53.64 ? 394  SER D CB    1 
HETATM 3988 MG MG    . MG  I 4 .  ? 58.203  21.428  130.375 1.00 25.00 ? 2002 MG  B MG    1 
HETATM 3989 MG MG    . MG  J 4 .  ? 39.354  46.837  177.125 1.00 24.26 ? 2001 MG  C MG    1 
HETATM 3990 O  O     . HOH K 5 .  ? 50.523  36.936  178.516 1.00 45.03 ? 1006 HOH E O     1 
HETATM 3991 O  O     . HOH K 5 .  ? 32.456  43.130  186.467 1.00 32.83 ? 1007 HOH E O     1 
HETATM 3992 O  O     . HOH K 5 .  ? 36.956  51.890  191.337 1.00 42.49 ? 1022 HOH E O     1 
HETATM 3993 O  O     . HOH K 5 .  ? 40.116  51.805  189.807 1.00 58.19 ? 1028 HOH E O     1 
HETATM 3994 O  O     . HOH K 5 .  ? 43.212  50.981  179.926 1.00 32.03 ? 1048 HOH E O     1 
HETATM 3995 O  O     . HOH K 5 .  ? 41.967  47.707  181.982 1.00 31.35 ? 1052 HOH E O     1 
HETATM 3996 O  O     . HOH K 5 .  ? 28.855  51.910  205.996 1.00 48.17 ? 1060 HOH E O     1 
HETATM 3997 O  O     . HOH K 5 .  ? 40.869  44.283  185.783 1.00 28.47 ? 1064 HOH E O     1 
HETATM 3998 O  O     . HOH K 5 .  ? 41.085  56.497  180.103 1.00 47.37 ? 1065 HOH E O     1 
HETATM 3999 O  O     . HOH K 5 .  ? 52.815  36.759  163.617 1.00 51.35 ? 1087 HOH E O     1 
HETATM 4000 O  O     . HOH K 5 .  ? 52.264  36.764  160.877 1.00 38.44 ? 1103 HOH E O     1 
HETATM 4001 O  O     . HOH K 5 .  ? 48.830  35.889  176.534 1.00 53.05 ? 1116 HOH E O     1 
HETATM 4002 O  O     . HOH K 5 .  ? 52.091  38.002  180.858 1.00 14.18 ? 1118 HOH E O     1 
HETATM 4003 O  O     . HOH K 5 .  ? 30.412  41.782  185.763 1.00 39.59 ? 1119 HOH E O     1 
HETATM 4004 O  O     . HOH K 5 .  ? 42.865  46.751  199.050 1.00 58.80 ? 1125 HOH E O     1 
HETATM 4005 O  O     . HOH K 5 .  ? 33.447  53.314  204.913 1.00 43.83 ? 1158 HOH E O     1 
HETATM 4006 O  O     . HOH K 5 .  ? 51.546  34.158  165.257 1.00 53.36 ? 1177 HOH E O     1 
HETATM 4007 O  O     . HOH K 5 .  ? 43.860  48.097  180.153 1.00 56.92 ? 1204 HOH E O     1 
HETATM 4008 O  O     . HOH K 5 .  ? 33.155  49.394  183.819 1.00 26.11 ? 1208 HOH E O     1 
HETATM 4009 O  O     . HOH K 5 .  ? 34.125  55.981  206.654 1.00 37.23 ? 1211 HOH E O     1 
HETATM 4010 O  O     . HOH K 5 .  ? 51.668  49.361  177.289 1.00 32.28 ? 1249 HOH E O     1 
HETATM 4011 O  O     . HOH K 5 .  ? 51.396  47.166  184.259 1.00 55.92 ? 1278 HOH E O     1 
HETATM 4012 O  O     . HOH K 5 .  ? 45.766  42.795  164.191 1.00 39.95 ? 1284 HOH E O     1 
HETATM 4013 O  O     . HOH L 5 .  ? 52.270  41.022  146.243 1.00 58.60 ? 1009 HOH F O     1 
HETATM 4014 O  O     . HOH L 5 .  ? 64.220  27.735  140.655 1.00 19.99 ? 1010 HOH F O     1 
HETATM 4015 O  O     . HOH L 5 .  ? 56.307  25.989  124.640 1.00 35.15 ? 1012 HOH F O     1 
HETATM 4016 O  O     . HOH L 5 .  ? 63.163  25.327  140.871 1.00 32.87 ? 1020 HOH F O     1 
HETATM 4017 O  O     . HOH L 5 .  ? 58.118  21.636  139.969 1.00 27.98 ? 1030 HOH F O     1 
HETATM 4018 O  O     . HOH L 5 .  ? 62.439  34.156  148.351 1.00 51.21 ? 1032 HOH F O     1 
HETATM 4019 O  O     . HOH L 5 .  ? 60.328  15.916  113.072 1.00 51.65 ? 1036 HOH F O     1 
HETATM 4020 O  O     . HOH L 5 .  ? 51.932  22.894  141.067 1.00 46.67 ? 1056 HOH F O     1 
HETATM 4021 O  O     . HOH L 5 .  ? 49.591  18.498  101.920 1.00 48.16 ? 1075 HOH F O     1 
HETATM 4022 O  O     . HOH L 5 .  ? 53.450  24.492  130.571 1.00 35.08 ? 1079 HOH F O     1 
HETATM 4023 O  O     . HOH L 5 .  ? 64.247  6.607   109.121 1.00 49.57 ? 1082 HOH F O     1 
HETATM 4024 O  O     . HOH L 5 .  ? 61.785  24.487  145.954 1.00 50.11 ? 1093 HOH F O     1 
HETATM 4025 O  O     . HOH L 5 .  ? 52.141  38.588  150.239 1.00 61.63 ? 1095 HOH F O     1 
HETATM 4026 O  O     . HOH L 5 .  ? 61.385  37.293  142.723 1.00 46.78 ? 1105 HOH F O     1 
HETATM 4027 O  O     . HOH L 5 .  ? 54.161  39.129  148.260 1.00 42.97 ? 1106 HOH F O     1 
HETATM 4028 O  O     . HOH L 5 .  ? 51.217  39.385  153.428 1.00 54.60 ? 1110 HOH F O     1 
HETATM 4029 O  O     . HOH L 5 .  ? 65.863  32.315  120.938 1.00 61.05 ? 1129 HOH F O     1 
HETATM 4030 O  O     . HOH L 5 .  ? 50.325  10.579  100.509 1.00 39.72 ? 1145 HOH F O     1 
HETATM 4031 O  O     . HOH L 5 .  ? 66.550  26.165  111.417 1.00 47.95 ? 1148 HOH F O     1 
HETATM 4032 O  O     . HOH L 5 .  ? 56.976  25.713  132.207 1.00 36.85 ? 1154 HOH F O     1 
HETATM 4033 O  O     . HOH L 5 .  ? 50.159  21.593  137.089 1.00 55.13 ? 1155 HOH F O     1 
HETATM 4034 O  O     . HOH L 5 .  ? 56.804  39.853  144.830 1.00 60.30 ? 1169 HOH F O     1 
HETATM 4035 O  O     . HOH L 5 .  ? 60.895  21.751  143.955 1.00 44.63 ? 1183 HOH F O     1 
HETATM 4036 O  O     . HOH L 5 .  ? 64.416  37.212  141.859 1.00 38.81 ? 1187 HOH F O     1 
HETATM 4037 O  O     . HOH L 5 .  ? 48.575  29.269  123.629 1.00 48.36 ? 1202 HOH F O     1 
HETATM 4038 O  O     . HOH L 5 .  ? 49.706  20.849  133.710 1.00 53.15 ? 1203 HOH F O     1 
HETATM 4039 O  O     . HOH L 5 .  ? 64.721  23.534  141.904 1.00 45.66 ? 1214 HOH F O     1 
HETATM 4040 O  O     . HOH L 5 .  ? 66.399  21.458  141.506 1.00 58.75 ? 1215 HOH F O     1 
HETATM 4041 O  O     . HOH L 5 .  ? 58.697  27.664  116.002 1.00 51.88 ? 1237 HOH F O     1 
HETATM 4042 O  O     . HOH L 5 .  ? 51.483  30.771  134.470 1.00 39.84 ? 1281 HOH F O     1 
HETATM 4043 O  O     . HOH L 5 .  ? 65.496  20.651  107.911 1.00 63.09 ? 1282 HOH F O     1 
HETATM 4044 O  O     . HOH L 5 .  ? 54.674  47.405  157.042 1.00 61.33 ? 1283 HOH F O     1 
HETATM 4045 O  O     . HOH L 5 .  ? 50.872  37.530  156.313 1.00 51.32 ? 1287 HOH F O     1 
HETATM 4046 O  O     . HOH M 5 .  ? 57.968  15.056  123.887 1.00 17.50 ? 1002 HOH G O     1 
HETATM 4047 O  O     . HOH M 5 .  ? 54.237  35.647  129.719 1.00 42.91 ? 1005 HOH G O     1 
HETATM 4048 O  O     . HOH M 5 .  ? 57.576  24.170  122.238 1.00 33.65 ? 1014 HOH G O     1 
HETATM 4049 O  O     . HOH M 5 .  ? 61.837  35.151  124.340 1.00 56.02 ? 1016 HOH G O     1 
HETATM 4050 O  O     . HOH M 5 .  ? 62.983  16.882  116.801 1.00 30.96 ? 1027 HOH G O     1 
HETATM 4051 O  O     . HOH M 5 .  ? 52.442  17.056  120.471 1.00 26.73 ? 1031 HOH G O     1 
HETATM 4052 O  O     . HOH M 5 .  ? 63.751  16.380  92.985  1.00 28.61 ? 1040 HOH G O     1 
HETATM 4053 O  O     . HOH M 5 .  ? 62.639  24.309  128.211 1.00 35.69 ? 1053 HOH G O     1 
HETATM 4054 O  O     . HOH M 5 .  ? 64.541  19.582  119.158 1.00 53.35 ? 1067 HOH G O     1 
HETATM 4055 O  O     . HOH M 5 .  ? 61.817  9.864   101.602 1.00 44.30 ? 1070 HOH G O     1 
HETATM 4056 O  O     . HOH M 5 .  ? 57.350  27.557  145.476 1.00 38.10 ? 1076 HOH G O     1 
HETATM 4057 O  O     . HOH M 5 .  ? 49.361  16.831  118.216 1.00 57.48 ? 1084 HOH G O     1 
HETATM 4058 O  O     . HOH M 5 .  ? 49.894  34.555  145.013 1.00 54.58 ? 1108 HOH G O     1 
HETATM 4059 O  O     . HOH M 5 .  ? 66.661  17.735  128.825 1.00 52.31 ? 1111 HOH G O     1 
HETATM 4060 O  O     . HOH M 5 .  ? 57.023  36.966  127.074 1.00 16.95 ? 1117 HOH G O     1 
HETATM 4061 O  O     . HOH M 5 .  ? 60.445  35.493  126.703 1.00 56.09 ? 1120 HOH G O     1 
HETATM 4062 O  O     . HOH M 5 .  ? 56.691  16.638  112.891 1.00 46.47 ? 1147 HOH G O     1 
HETATM 4063 O  O     . HOH M 5 .  ? 58.230  40.451  135.755 1.00 53.07 ? 1166 HOH G O     1 
HETATM 4064 O  O     . HOH M 5 .  ? 60.331  23.195  126.079 1.00 37.29 ? 1170 HOH G O     1 
HETATM 4065 O  O     . HOH M 5 .  ? 52.745  37.459  146.696 1.00 33.51 ? 1185 HOH G O     1 
HETATM 4066 O  O     . HOH M 5 .  ? 54.203  38.199  144.332 1.00 44.31 ? 1186 HOH G O     1 
HETATM 4067 O  O     . HOH M 5 .  ? 52.221  26.300  112.260 1.00 59.07 ? 1200 HOH G O     1 
HETATM 4068 O  O     . HOH M 5 .  ? 57.106  25.580  111.634 1.00 47.67 ? 1201 HOH G O     1 
HETATM 4069 O  O     . HOH M 5 .  ? 58.796  19.319  99.209  1.00 49.70 ? 1209 HOH G O     1 
HETATM 4070 O  O     . HOH M 5 .  ? 58.358  25.884  113.901 1.00 41.15 ? 1239 HOH G O     1 
HETATM 4071 O  O     . HOH M 5 .  ? 55.983  28.934  143.593 1.00 38.89 ? 1279 HOH G O     1 
HETATM 4072 O  O     . HOH M 5 .  ? 52.765  30.097  140.388 1.00 22.63 ? 1280 HOH G O     1 
HETATM 4073 O  O     . HOH N 5 .  ? 53.959  46.678  160.559 1.00 36.94 ? 1004 HOH H O     1 
HETATM 4074 O  O     . HOH N 5 .  ? 38.118  38.581  178.156 1.00 43.52 ? 1008 HOH H O     1 
HETATM 4075 O  O     . HOH N 5 .  ? 44.573  37.339  172.441 1.00 32.91 ? 1013 HOH H O     1 
HETATM 4076 O  O     . HOH N 5 .  ? 34.325  50.040  194.117 1.00 67.02 ? 1015 HOH H O     1 
HETATM 4077 O  O     . HOH N 5 .  ? 49.391  48.274  189.316 1.00 52.52 ? 1021 HOH H O     1 
HETATM 4078 O  O     . HOH N 5 .  ? 42.916  38.151  184.175 1.00 27.01 ? 1025 HOH H O     1 
HETATM 4079 O  O     . HOH N 5 .  ? 39.798  41.987  176.640 1.00 36.99 ? 1037 HOH H O     1 
HETATM 4080 O  O     . HOH N 5 .  ? 29.547  50.944  203.561 1.00 51.22 ? 1039 HOH H O     1 
HETATM 4081 O  O     . HOH N 5 .  ? 54.814  41.227  166.083 1.00 34.79 ? 1050 HOH H O     1 
HETATM 4082 O  O     . HOH N 5 .  ? 28.657  41.907  209.759 1.00 24.90 ? 1054 HOH H O     1 
HETATM 4083 O  O     . HOH N 5 .  ? 45.716  50.904  167.846 1.00 27.00 ? 1069 HOH H O     1 
HETATM 4084 O  O     . HOH N 5 .  ? 37.702  35.272  175.390 1.00 47.81 ? 1072 HOH H O     1 
HETATM 4085 O  O     . HOH N 5 .  ? 45.400  53.360  166.923 1.00 46.37 ? 1073 HOH H O     1 
HETATM 4086 O  O     . HOH N 5 .  ? 27.905  38.629  209.184 1.00 40.89 ? 1086 HOH H O     1 
HETATM 4087 O  O     . HOH N 5 .  ? 42.637  56.359  191.668 1.00 56.69 ? 1096 HOH H O     1 
HETATM 4088 O  O     . HOH N 5 .  ? 32.597  42.440  206.609 1.00 50.94 ? 1099 HOH H O     1 
HETATM 4089 O  O     . HOH N 5 .  ? 52.882  36.288  153.456 1.00 50.65 ? 1102 HOH H O     1 
HETATM 4090 O  O     . HOH N 5 .  ? 43.774  42.391  192.450 1.00 43.48 ? 1109 HOH H O     1 
HETATM 4091 O  O     . HOH N 5 .  ? 60.855  42.476  155.188 1.00 63.89 ? 1113 HOH H O     1 
HETATM 4092 O  O     . HOH N 5 .  ? 52.604  41.849  183.787 1.00 48.09 ? 1128 HOH H O     1 
HETATM 4093 O  O     . HOH N 5 .  ? 26.736  43.654  208.750 1.00 29.19 ? 1140 HOH H O     1 
HETATM 4094 O  O     . HOH N 5 .  ? 41.175  35.814  183.052 1.00 43.61 ? 1146 HOH H O     1 
HETATM 4095 O  O     . HOH N 5 .  ? 30.006  52.871  201.357 1.00 53.70 ? 1159 HOH H O     1 
HETATM 4096 O  O     . HOH N 5 .  ? 28.574  57.916  199.638 1.00 45.81 ? 1160 HOH H O     1 
HETATM 4097 O  O     . HOH N 5 .  ? 29.950  36.513  213.715 1.00 44.05 ? 1163 HOH H O     1 
HETATM 4098 O  O     . HOH N 5 .  ? 29.782  37.820  211.248 1.00 43.87 ? 1165 HOH H O     1 
HETATM 4099 O  O     . HOH N 5 .  ? 48.305  50.432  168.221 1.00 24.54 ? 1173 HOH H O     1 
HETATM 4100 O  O     . HOH N 5 .  ? 54.202  36.720  158.942 1.00 51.92 ? 1178 HOH H O     1 
HETATM 4101 O  O     . HOH N 5 .  ? 33.166  35.892  170.987 1.00 69.67 ? 1206 HOH H O     1 
HETATM 4102 O  O     . HOH N 5 .  ? 34.247  39.380  169.617 1.00 57.75 ? 1218 HOH H O     1 
HETATM 4103 O  O     . HOH N 5 .  ? 27.555  55.624  199.008 1.00 48.27 ? 1220 HOH H O     1 
HETATM 4104 O  O     . HOH N 5 .  ? 22.382  50.696  200.986 1.00 47.63 ? 1228 HOH H O     1 
HETATM 4105 O  O     . HOH N 5 .  ? 51.856  44.671  186.966 1.00 50.45 ? 1253 HOH H O     1 
HETATM 4106 O  O     . HOH N 5 .  ? 45.194  39.353  167.005 1.00 16.93 ? 1258 HOH H O     1 
HETATM 4107 O  O     . HOH N 5 .  ? 47.991  32.664  184.382 1.00 68.46 ? 1260 HOH H O     1 
HETATM 4108 O  O     . HOH N 5 .  ? 35.914  42.281  168.711 1.00 52.82 ? 1263 HOH H O     1 
HETATM 4109 O  O     . HOH N 5 .  ? 42.041  49.989  167.963 1.00 37.12 ? 1265 HOH H O     1 
HETATM 4110 O  O     . HOH N 5 .  ? 41.506  51.041  164.264 1.00 48.68 ? 1266 HOH H O     1 
HETATM 4111 O  O     . HOH N 5 .  ? 45.661  36.221  175.270 1.00 66.32 ? 1285 HOH H O     1 
HETATM 4112 O  O     . HOH N 5 .  ? 51.783  37.521  190.828 1.00 54.89 ? 1286 HOH H O     1 
HETATM 4113 O  O     . HOH O 5 .  ? 58.964  -15.134 140.642 1.00 27.48 ? 1003 HOH A O     1 
HETATM 4114 O  O     . HOH O 5 .  ? 65.992  31.136  131.913 1.00 29.01 ? 1018 HOH A O     1 
HETATM 4115 O  O     . HOH O 5 .  ? 46.219  -9.932  146.412 1.00 47.70 ? 1029 HOH A O     1 
HETATM 4116 O  O     . HOH O 5 .  ? 64.492  12.695  127.943 1.00 35.63 ? 1034 HOH A O     1 
HETATM 4117 O  O     . HOH O 5 .  ? 55.011  -11.570 150.163 1.00 53.41 ? 1041 HOH A O     1 
HETATM 4118 O  O     . HOH O 5 .  ? 60.559  20.444  126.707 1.00 18.45 ? 1043 HOH A O     1 
HETATM 4119 O  O     . HOH O 5 .  ? 62.178  37.089  139.863 1.00 51.53 ? 1051 HOH A O     1 
HETATM 4120 O  O     . HOH O 5 .  ? 49.263  3.150   127.176 1.00 57.70 ? 1057 HOH A O     1 
HETATM 4121 O  O     . HOH O 5 .  ? 61.768  34.254  140.081 1.00 33.17 ? 1061 HOH A O     1 
HETATM 4122 O  O     . HOH O 5 .  ? 51.357  -5.696  145.830 1.00 30.86 ? 1062 HOH A O     1 
HETATM 4123 O  O     . HOH O 5 .  ? 67.506  7.244   136.392 1.00 37.15 ? 1094 HOH A O     1 
HETATM 4124 O  O     . HOH O 5 .  ? 44.358  -8.272  141.414 1.00 38.96 ? 1104 HOH A O     1 
HETATM 4125 O  O     . HOH O 5 .  ? 45.445  5.680   140.578 1.00 44.44 ? 1126 HOH A O     1 
HETATM 4126 O  O     . HOH O 5 .  ? 55.470  15.582  123.080 1.00 25.68 ? 1127 HOH A O     1 
HETATM 4127 O  O     . HOH O 5 .  ? 70.440  34.700  134.366 1.00 56.85 ? 1135 HOH A O     1 
HETATM 4128 O  O     . HOH O 5 .  ? 61.457  9.021   120.147 1.00 65.04 ? 1137 HOH A O     1 
HETATM 4129 O  O     . HOH O 5 .  ? 47.728  4.214   134.305 1.00 35.91 ? 1150 HOH A O     1 
HETATM 4130 O  O     . HOH O 5 .  ? 68.476  11.677  127.752 1.00 56.70 ? 1152 HOH A O     1 
HETATM 4131 O  O     . HOH O 5 .  ? 66.561  10.746  125.457 1.00 36.98 ? 1153 HOH A O     1 
HETATM 4132 O  O     . HOH O 5 .  ? 63.468  6.018   120.076 1.00 58.25 ? 1161 HOH A O     1 
HETATM 4133 O  O     . HOH O 5 .  ? 46.652  2.678   142.074 1.00 45.43 ? 1168 HOH A O     1 
HETATM 4134 O  O     . HOH O 5 .  ? 61.541  17.164  144.570 1.00 43.44 ? 1184 HOH A O     1 
HETATM 4135 O  O     . HOH O 5 .  ? 70.729  24.985  136.296 1.00 50.51 ? 1188 HOH A O     1 
HETATM 4136 O  O     . HOH O 5 .  ? 65.003  16.289  143.566 1.00 49.63 ? 1189 HOH A O     1 
HETATM 4137 O  O     . HOH O 5 .  ? 65.771  12.995  124.475 1.00 54.77 ? 1190 HOH A O     1 
HETATM 4138 O  O     . HOH O 5 .  ? 56.444  -22.892 155.678 1.00 55.15 ? 1191 HOH A O     1 
HETATM 4139 O  O     . HOH O 5 .  ? 55.514  -10.297 137.187 1.00 40.00 ? 1194 HOH A O     1 
HETATM 4140 O  O     . HOH O 5 .  ? 54.429  -14.319 151.196 1.00 38.78 ? 1195 HOH A O     1 
HETATM 4141 O  O     . HOH O 5 .  ? 52.527  -12.765 150.426 1.00 47.54 ? 1196 HOH A O     1 
HETATM 4142 O  O     . HOH O 5 .  ? 52.986  -10.708 153.169 1.00 46.63 ? 1197 HOH A O     1 
HETATM 4143 O  O     . HOH O 5 .  ? 56.085  -17.994 155.488 1.00 48.25 ? 1198 HOH A O     1 
HETATM 4144 O  O     . HOH O 5 .  ? 57.770  -19.787 156.474 1.00 42.96 ? 1199 HOH A O     1 
HETATM 4145 O  O     . HOH O 5 .  ? 64.080  45.644  145.834 1.00 56.18 ? 1212 HOH A O     1 
HETATM 4146 O  O     . HOH O 5 .  ? 67.672  22.056  139.180 1.00 48.68 ? 1213 HOH A O     1 
HETATM 4147 O  O     . HOH O 5 .  ? 63.543  18.511  142.933 1.00 49.00 ? 1216 HOH A O     1 
HETATM 4148 O  O     . HOH O 5 .  ? 70.142  10.031  125.273 1.00 63.88 ? 1217 HOH A O     1 
HETATM 4149 O  O     . HOH O 5 .  ? 67.574  5.346   121.271 1.00 66.97 ? 1219 HOH A O     1 
HETATM 4150 O  O     . HOH O 5 .  ? 48.897  2.875   132.425 1.00 42.86 ? 1225 HOH A O     1 
HETATM 4151 O  O     . HOH O 5 .  ? 50.080  8.062   124.974 1.00 56.41 ? 1227 HOH A O     1 
HETATM 4152 O  O     . HOH O 5 .  ? 48.429  0.540   143.976 1.00 43.54 ? 1229 HOH A O     1 
HETATM 4153 O  O     . HOH O 5 .  ? 53.448  -9.145  135.591 1.00 52.55 ? 1230 HOH A O     1 
HETATM 4154 O  O     . HOH O 5 .  ? 47.660  -16.912 147.331 1.00 51.57 ? 1233 HOH A O     1 
HETATM 4155 O  O     . HOH O 5 .  ? 51.066  -15.055 140.244 1.00 46.60 ? 1234 HOH A O     1 
HETATM 4156 O  O     . HOH O 5 .  ? 49.011  -10.192 146.415 1.00 61.75 ? 1235 HOH A O     1 
HETATM 4157 O  O     . HOH O 5 .  ? 51.040  -3.943  143.985 1.00 44.78 ? 1264 HOH A O     1 
HETATM 4158 O  O     . HOH O 5 .  ? 60.013  21.035  129.480 1.00 64.54 ? 2009 HOH A O     1 
HETATM 4159 O  O     . HOH O 5 .  ? 58.898  23.252  130.706 1.00 55.67 ? 2012 HOH A O     1 
HETATM 4160 O  O     . HOH O 5 .  ? 59.132  21.069  132.256 1.00 55.24 ? 2013 HOH A O     1 
HETATM 4161 O  O     . HOH P 5 .  ? 46.215  13.781  132.079 1.00 35.59 ? 1017 HOH B O     1 
HETATM 4162 O  O     . HOH P 5 .  ? 56.269  23.693  133.983 1.00 26.68 ? 1035 HOH B O     1 
HETATM 4163 O  O     . HOH P 5 .  ? 58.930  -7.199  137.852 1.00 21.15 ? 1042 HOH B O     1 
HETATM 4164 O  O     . HOH P 5 .  ? 47.352  30.604  119.364 1.00 55.88 ? 1044 HOH B O     1 
HETATM 4165 O  O     . HOH P 5 .  ? 63.200  -7.945  138.622 1.00 34.72 ? 1045 HOH B O     1 
HETATM 4166 O  O     . HOH P 5 .  ? 47.497  6.870   134.163 1.00 39.34 ? 1046 HOH B O     1 
HETATM 4167 O  O     . HOH P 5 .  ? 47.131  8.054   136.553 1.00 31.96 ? 1047 HOH B O     1 
HETATM 4168 O  O     . HOH P 5 .  ? 64.943  -0.377  134.664 1.00 41.61 ? 1059 HOH B O     1 
HETATM 4169 O  O     . HOH P 5 .  ? 63.522  4.229   145.821 1.00 38.98 ? 1080 HOH B O     1 
HETATM 4170 O  O     . HOH P 5 .  ? 67.229  0.870   135.142 1.00 58.37 ? 1097 HOH B O     1 
HETATM 4171 O  O     . HOH P 5 .  ? 46.524  23.913  120.993 1.00 57.33 ? 1098 HOH B O     1 
HETATM 4172 O  O     . HOH P 5 .  ? 49.231  19.843  141.815 1.00 34.69 ? 1107 HOH B O     1 
HETATM 4173 O  O     . HOH P 5 .  ? 46.066  21.659  124.037 1.00 60.24 ? 1121 HOH B O     1 
HETATM 4174 O  O     . HOH P 5 .  ? 45.673  10.159  135.494 1.00 46.97 ? 1133 HOH B O     1 
HETATM 4175 O  O     . HOH P 5 .  ? 44.479  6.772   134.223 1.00 48.66 ? 1142 HOH B O     1 
HETATM 4176 O  O     . HOH P 5 .  ? 44.136  3.969   133.998 1.00 51.92 ? 1149 HOH B O     1 
HETATM 4177 O  O     . HOH P 5 .  ? 48.535  17.513  123.899 1.00 42.85 ? 1151 HOH B O     1 
HETATM 4178 O  O     . HOH P 5 .  ? 51.199  18.551  138.754 1.00 48.79 ? 1156 HOH B O     1 
HETATM 4179 O  O     . HOH P 5 .  ? 49.687  22.177  129.312 1.00 34.88 ? 1157 HOH B O     1 
HETATM 4180 O  O     . HOH P 5 .  ? 49.298  4.026   142.052 1.00 36.71 ? 1167 HOH B O     1 
HETATM 4181 O  O     . HOH P 5 .  ? 52.440  -0.944  145.592 1.00 34.40 ? 1171 HOH B O     1 
HETATM 4182 O  O     . HOH P 5 .  ? 65.725  6.857   144.446 1.00 49.22 ? 1176 HOH B O     1 
HETATM 4183 O  O     . HOH P 5 .  ? 47.612  6.952   145.870 1.00 46.84 ? 1192 HOH B O     1 
HETATM 4184 O  O     . HOH P 5 .  ? 51.399  4.972   146.252 1.00 55.87 ? 1193 HOH B O     1 
HETATM 4185 O  O     . HOH P 5 .  ? 46.885  12.033  129.486 1.00 42.16 ? 1221 HOH B O     1 
HETATM 4186 O  O     . HOH P 5 .  ? 48.330  13.192  127.062 1.00 54.71 ? 1222 HOH B O     1 
HETATM 4187 O  O     . HOH P 5 .  ? 45.690  8.174   129.927 1.00 55.82 ? 1223 HOH B O     1 
HETATM 4188 O  O     . HOH P 5 .  ? 44.946  11.791  133.493 1.00 36.03 ? 1224 HOH B O     1 
HETATM 4189 O  O     . HOH P 5 .  ? 58.505  -9.862  135.836 1.00 58.33 ? 1231 HOH B O     1 
HETATM 4190 O  O     . HOH P 5 .  ? 49.312  32.745  120.384 1.00 45.69 ? 1236 HOH B O     1 
HETATM 4191 O  O     . HOH P 5 .  ? 51.777  35.147  118.895 1.00 53.63 ? 1238 HOH B O     1 
HETATM 4192 O  O     . HOH P 5 .  ? 46.418  19.255  141.422 1.00 42.82 ? 1244 HOH B O     1 
HETATM 4193 O  O     . HOH P 5 .  ? 60.548  22.366  140.096 1.00 34.87 ? 1245 HOH B O     1 
HETATM 4194 O  O     . HOH P 5 .  ? 54.106  -2.117  147.182 1.00 59.05 ? 1246 HOH B O     1 
HETATM 4195 O  O     . HOH P 5 .  ? 53.656  28.999  123.122 1.00 53.98 ? 1261 HOH B O     1 
HETATM 4196 O  O     . HOH P 5 .  ? 56.535  21.730  131.297 1.00 59.66 ? 2010 HOH B O     1 
HETATM 4197 O  O     . HOH P 5 .  ? 57.740  19.456  130.256 1.00 54.56 ? 2011 HOH B O     1 
HETATM 4198 O  O     . HOH P 5 .  ? 57.424  21.817  128.657 1.00 61.78 ? 2014 HOH B O     1 
HETATM 4199 O  O     . HOH Q 5 .  ? 55.587  43.761  176.267 1.00 40.94 ? 1001 HOH C O     1 
HETATM 4200 O  O     . HOH Q 5 .  ? 23.600  51.282  182.814 1.00 44.22 ? 1011 HOH C O     1 
HETATM 4201 O  O     . HOH Q 5 .  ? -1.401  64.582  158.013 1.00 40.77 ? 1023 HOH C O     1 
HETATM 4202 O  O     . HOH Q 5 .  ? 34.052  58.965  183.692 1.00 36.78 ? 1026 HOH C O     1 
HETATM 4203 O  O     . HOH Q 5 .  ? 34.466  55.671  181.529 1.00 47.32 ? 1033 HOH C O     1 
HETATM 4204 O  O     . HOH Q 5 .  ? 16.660  49.749  174.489 1.00 30.52 ? 1055 HOH C O     1 
HETATM 4205 O  O     . HOH Q 5 .  ? 16.311  52.452  174.523 1.00 19.02 ? 1068 HOH C O     1 
HETATM 4206 O  O     . HOH Q 5 .  ? 21.755  64.729  174.382 1.00 51.22 ? 1071 HOH C O     1 
HETATM 4207 O  O     . HOH Q 5 .  ? 52.833  44.853  168.603 1.00 27.78 ? 1074 HOH C O     1 
HETATM 4208 O  O     . HOH Q 5 .  ? 46.937  54.470  176.875 1.00 47.94 ? 1077 HOH C O     1 
HETATM 4209 O  O     . HOH Q 5 .  ? 56.644  51.490  175.348 1.00 55.19 ? 1081 HOH C O     1 
HETATM 4210 O  O     . HOH Q 5 .  ? 18.804  48.366  174.188 1.00 40.72 ? 1083 HOH C O     1 
HETATM 4211 O  O     . HOH Q 5 .  ? 4.742   60.477  165.272 1.00 36.69 ? 1085 HOH C O     1 
HETATM 4212 O  O     . HOH Q 5 .  ? 38.564  59.487  170.555 1.00 36.66 ? 1089 HOH C O     1 
HETATM 4213 O  O     . HOH Q 5 .  ? 14.467  54.863  162.790 1.00 32.48 ? 1090 HOH C O     1 
HETATM 4214 O  O     . HOH Q 5 .  ? 42.766  57.817  170.371 1.00 30.35 ? 1091 HOH C O     1 
HETATM 4215 O  O     . HOH Q 5 .  ? 39.559  61.558  171.889 1.00 55.40 ? 1092 HOH C O     1 
HETATM 4216 O  O     . HOH Q 5 .  ? 44.879  56.055  170.055 1.00 49.93 ? 1100 HOH C O     1 
HETATM 4217 O  O     . HOH Q 5 .  ? 27.502  51.998  186.965 1.00 49.69 ? 1101 HOH C O     1 
HETATM 4218 O  O     . HOH Q 5 .  ? 20.354  49.367  164.058 1.00 33.71 ? 1112 HOH C O     1 
HETATM 4219 O  O     . HOH Q 5 .  ? 30.211  54.684  187.829 1.00 57.79 ? 1115 HOH C O     1 
HETATM 4220 O  O     . HOH Q 5 .  ? 11.407  52.408  165.691 1.00 24.34 ? 1123 HOH C O     1 
HETATM 4221 O  O     . HOH Q 5 .  ? 41.112  44.747  173.859 1.00 43.68 ? 1130 HOH C O     1 
HETATM 4222 O  O     . HOH Q 5 .  ? 39.666  48.910  181.414 1.00 22.72 ? 1131 HOH C O     1 
HETATM 4223 O  O     . HOH Q 5 .  ? 13.872  53.583  173.355 1.00 20.34 ? 1134 HOH C O     1 
HETATM 4224 O  O     . HOH Q 5 .  ? 68.094  45.224  173.555 1.00 51.92 ? 1136 HOH C O     1 
HETATM 4225 O  O     . HOH Q 5 .  ? 26.247  48.598  183.389 1.00 38.40 ? 1139 HOH C O     1 
HETATM 4226 O  O     . HOH Q 5 .  ? 15.161  62.736  170.105 1.00 23.86 ? 1162 HOH C O     1 
HETATM 4227 O  O     . HOH Q 5 .  ? 40.009  53.840  166.112 1.00 38.23 ? 1174 HOH C O     1 
HETATM 4228 O  O     . HOH Q 5 .  ? 44.351  54.806  178.090 1.00 49.22 ? 1175 HOH C O     1 
HETATM 4229 O  O     . HOH Q 5 .  ? 45.145  52.773  179.716 1.00 33.90 ? 1205 HOH C O     1 
HETATM 4230 O  O     . HOH Q 5 .  ? 34.885  61.752  180.895 1.00 54.09 ? 1207 HOH C O     1 
HETATM 4231 O  O     . HOH Q 5 .  ? 10.312  53.443  171.480 1.00 48.59 ? 1240 HOH C O     1 
HETATM 4232 O  O     . HOH Q 5 .  ? 12.094  57.317  171.491 1.00 38.36 ? 1241 HOH C O     1 
HETATM 4233 O  O     . HOH Q 5 .  ? 8.954   52.806  169.238 1.00 48.11 ? 1242 HOH C O     1 
HETATM 4234 O  O     . HOH Q 5 .  ? 11.087  49.994  166.538 1.00 42.65 ? 1243 HOH C O     1 
HETATM 4235 O  O     . HOH Q 5 .  ? 52.181  55.288  172.606 1.00 49.04 ? 1247 HOH C O     1 
HETATM 4236 O  O     . HOH Q 5 .  ? 54.533  53.205  175.863 1.00 41.11 ? 1248 HOH C O     1 
HETATM 4237 O  O     . HOH Q 5 .  ? 37.793  55.461  178.925 1.00 45.92 ? 1250 HOH C O     1 
HETATM 4238 O  O     . HOH Q 5 .  ? 10.661  60.891  169.990 1.00 58.26 ? 1251 HOH C O     1 
HETATM 4239 O  O     . HOH Q 5 .  ? 7.035   63.208  167.933 1.00 59.54 ? 1254 HOH C O     1 
HETATM 4240 O  O     . HOH Q 5 .  ? 13.810  56.405  160.740 1.00 34.20 ? 1255 HOH C O     1 
HETATM 4241 O  O     . HOH Q 5 .  ? 1.924   60.680  162.775 1.00 42.89 ? 1256 HOH C O     1 
HETATM 4242 O  O     . HOH Q 5 .  ? 2.885   70.731  149.498 1.00 48.11 ? 1257 HOH C O     1 
HETATM 4243 O  O     . HOH Q 5 .  ? 27.817  49.318  185.434 1.00 59.84 ? 1262 HOH C O     1 
HETATM 4244 O  O     . HOH Q 5 .  ? 37.864  53.932  163.609 1.00 51.48 ? 1267 HOH C O     1 
HETATM 4245 O  O     . HOH Q 5 .  ? 38.999  56.205  164.682 1.00 56.03 ? 1269 HOH C O     1 
HETATM 4246 O  O     . HOH Q 5 .  ? 17.641  50.397  162.228 1.00 42.99 ? 1275 HOH C O     1 
HETATM 4247 O  O     . HOH R 5 .  ? 27.012  40.860  173.856 1.00 31.35 ? 1019 HOH D O     1 
HETATM 4248 O  O     . HOH R 5 .  ? 40.258  48.171  168.021 1.00 23.89 ? 1024 HOH D O     1 
HETATM 4249 O  O     . HOH R 5 .  ? 42.040  42.486  183.220 1.00 27.41 ? 1038 HOH D O     1 
HETATM 4250 O  O     . HOH R 5 .  ? 22.934  44.884  169.843 1.00 31.11 ? 1049 HOH D O     1 
HETATM 4251 O  O     . HOH R 5 .  ? 44.435  32.874  186.214 1.00 31.80 ? 1058 HOH D O     1 
HETATM 4252 O  O     . HOH R 5 .  ? 33.613  43.422  168.417 1.00 38.76 ? 1063 HOH D O     1 
HETATM 4253 O  O     . HOH R 5 .  ? 34.043  41.364  165.157 1.00 42.17 ? 1066 HOH D O     1 
HETATM 4254 O  O     . HOH R 5 .  ? 24.390  64.013  173.892 1.00 34.17 ? 1078 HOH D O     1 
HETATM 4255 O  O     . HOH R 5 .  ? 18.842  54.767  161.019 1.00 39.68 ? 1088 HOH D O     1 
HETATM 4256 O  O     . HOH R 5 .  ? 41.572  31.788  186.840 1.00 55.80 ? 1114 HOH D O     1 
HETATM 4257 O  O     . HOH R 5 .  ? 30.163  64.859  170.160 1.00 53.46 ? 1122 HOH D O     1 
HETATM 4258 O  O     . HOH R 5 .  ? 36.909  41.074  165.198 1.00 40.22 ? 1124 HOH D O     1 
HETATM 4259 O  O     . HOH R 5 .  ? 17.134  66.795  169.500 1.00 43.75 ? 1132 HOH D O     1 
HETATM 4260 O  O     . HOH R 5 .  ? 30.605  39.609  182.712 1.00 45.57 ? 1138 HOH D O     1 
HETATM 4261 O  O     . HOH R 5 .  ? 24.749  40.787  172.084 1.00 39.57 ? 1141 HOH D O     1 
HETATM 4262 O  O     . HOH R 5 .  ? 25.888  41.268  176.687 1.00 53.03 ? 1143 HOH D O     1 
HETATM 4263 O  O     . HOH R 5 .  ? 28.319  41.045  180.667 1.00 55.54 ? 1144 HOH D O     1 
HETATM 4264 O  O     . HOH R 5 .  ? 29.018  40.186  166.780 1.00 30.83 ? 1164 HOH D O     1 
HETATM 4265 O  O     . HOH R 5 .  ? 34.529  42.085  172.203 1.00 45.62 ? 1172 HOH D O     1 
HETATM 4266 O  O     . HOH R 5 .  ? 18.375  56.789  159.515 1.00 57.27 ? 1179 HOH D O     1 
HETATM 4267 O  O     . HOH R 5 .  ? 22.637  50.649  160.774 1.00 40.51 ? 1180 HOH D O     1 
HETATM 4268 O  O     . HOH R 5 .  ? 22.575  47.577  160.920 1.00 45.71 ? 1181 HOH D O     1 
HETATM 4269 O  O     . HOH R 5 .  ? 34.365  41.572  187.965 1.00 25.09 ? 1182 HOH D O     1 
HETATM 4270 O  O     . HOH R 5 .  ? 8.704   67.108  166.647 1.00 21.94 ? 1210 HOH D O     1 
HETATM 4271 O  O     . HOH R 5 .  ? 23.723  42.506  170.615 1.00 45.24 ? 1226 HOH D O     1 
HETATM 4272 O  O     . HOH R 5 .  ? 28.166  38.139  165.449 1.00 26.98 ? 1232 HOH D O     1 
HETATM 4273 O  O     . HOH R 5 .  ? 9.911   66.942  169.376 1.00 65.00 ? 1252 HOH D O     1 
HETATM 4274 O  O     . HOH R 5 .  ? 46.987  32.511  187.681 1.00 46.83 ? 1259 HOH D O     1 
HETATM 4275 O  O     . HOH R 5 .  ? 38.505  58.615  166.072 1.00 55.86 ? 1268 HOH D O     1 
HETATM 4276 O  O     . HOH R 5 .  ? 24.757  52.034  161.283 1.00 50.10 ? 1270 HOH D O     1 
HETATM 4277 O  O     . HOH R 5 .  ? 28.660  55.149  161.868 1.00 48.09 ? 1271 HOH D O     1 
HETATM 4278 O  O     . HOH R 5 .  ? 26.781  57.318  160.400 1.00 56.09 ? 1272 HOH D O     1 
HETATM 4279 O  O     . HOH R 5 .  ? 24.526  56.833  158.789 1.00 48.43 ? 1273 HOH D O     1 
HETATM 4280 O  O     . HOH R 5 .  ? 28.421  61.653  162.626 1.00 51.50 ? 1274 HOH D O     1 
HETATM 4281 O  O     . HOH R 5 .  ? 17.260  65.667  159.206 1.00 58.08 ? 1276 HOH D O     1 
HETATM 4282 O  O     . HOH R 5 .  ? 12.499  65.167  156.588 1.00 51.12 ? 1277 HOH D O     1 
HETATM 4283 O  O     . HOH R 5 .  ? 41.356  47.301  177.215 1.00 48.90 ? 2003 HOH D O     1 
HETATM 4284 O  O     . HOH R 5 .  ? 37.483  46.365  177.143 1.00 57.49 ? 2004 HOH D O     1 
HETATM 4285 O  O     . HOH R 5 .  ? 39.814  44.885  177.435 1.00 51.88 ? 2005 HOH D O     1 
HETATM 4286 O  O     . HOH R 5 .  ? 39.024  48.789  177.137 1.00 54.54 ? 2006 HOH D O     1 
HETATM 4287 O  O     . HOH R 5 .  ? 39.262  47.123  179.232 1.00 53.78 ? 2007 HOH D O     1 
HETATM 4288 O  O     . HOH R 5 .  ? 39.468  46.663  175.210 1.00 56.38 ? 2008 HOH D O     1 
A 1 1  DT  1  1   1   DT  T   E . n 
A 1 2  DT  2  2   2   DT  T   E . n 
A 1 3  DG  3  3   3   DG  G   E . n 
A 1 4  DC  4  4   4   DC  C   E . n 
A 1 5  DA  5  5   5   DA  A   E . n 
A 1 6  DG  6  6   6   DG  G   E . n 
A 1 7  DT  7  7   7   DT  T   E . n 
A 1 8  DG  8  8   8   DG  G   E . n 
A 1 9  DG  9  9   9   DG  G   E . n 
A 1 10 DG  10 10  10  DG  G   E . n 
A 1 11 DG  11 11  11  DG  G   E . n 
A 1 12 DT  12 12  12  DT  T   E . n 
A 1 13 DG  13 13  13  DG  G   E . n 
A 1 14 DA  14 14  14  DA  A   E . n 
A 1 15 DT  15 15  15  DT  T   E . n 
A 1 16 DC  16 16  16  DC  C   E . n 
A 1 17 DT  17 17  17  DT  T   E . n 
B 2 1  DC  1  18  18  DC  C   F . n 
B 2 2  DA  2  19  19  DA  A   F . n 
B 2 3  DT  3  20  20  DT  T   F . n 
B 2 4  DG  4  21  21  DG  G   F . n 
B 2 5  DA  5  22  22  DA  A   F . n 
B 2 6  DG  6  23  23  DG  G   F . n 
B 2 7  DA  7  24  24  DA  A   F . n 
B 2 8  DT  8  25  25  DT  T   F . n 
B 2 9  DC  9  26  26  DC  C   F . n 
B 2 10 DA  10 27  27  DA  A   F . n 
B 2 11 DC  11 28  28  DC  C   F . n 
B 2 12 DC  12 29  29  DC  C   F . n 
B 2 13 DC  13 30  30  DC  C   F . n 
B 2 14 DC  14 31  31  DC  C   F . n 
B 2 15 DA  15 32  32  DA  A   F . n 
B 2 16 DC  16 33  33  DC  C   F . n 
B 2 17 DT  17 34  34  DT  T   F . n 
B 2 18 DG  18 35  35  DG  G   F . n 
B 2 19 DC  19 36  36  DC  C   F . n 
B 2 20 DA  20 37  37  DA  A   F . n 
B 2 21 DA  21 38  38  DA  A   F . n 
C 1 1  DT  1  39  39  DT  T   G . n 
C 1 2  DT  2  40  40  DT  T   G . n 
C 1 3  DG  3  41  41  DG  G   G . n 
C 1 4  DC  4  42  42  DC  C   G . n 
C 1 5  DA  5  43  43  DA  A   G . n 
C 1 6  DG  6  44  44  DG  G   G . n 
C 1 7  DT  7  45  45  DT  T   G . n 
C 1 8  DG  8  46  46  DG  G   G . n 
C 1 9  DG  9  47  47  DG  G   G . n 
C 1 10 DG  10 48  48  DG  G   G . n 
C 1 11 DG  11 49  49  DG  G   G . n 
C 1 12 DT  12 50  50  DT  T   G . n 
C 1 13 DG  13 51  51  DG  G   G . n 
C 1 14 DA  14 52  52  DA  A   G . n 
C 1 15 DT  15 53  53  DT  T   G . n 
C 1 16 DC  16 54  54  DC  C   G . n 
C 1 17 DT  17 55  55  DT  T   G . n 
D 2 1  DC  1  56  56  DC  C   H . n 
D 2 2  DA  2  57  57  DA  A   H . n 
D 2 3  DT  3  58  58  DT  T   H . n 
D 2 4  DG  4  59  59  DG  G   H . n 
D 2 5  DA  5  60  60  DA  A   H . n 
D 2 6  DG  6  61  61  DG  G   H . n 
D 2 7  DA  7  62  62  DA  A   H . n 
D 2 8  DT  8  63  63  DT  T   H . n 
D 2 9  DC  9  64  64  DC  C   H . n 
D 2 10 DA  10 65  65  DA  A   H . n 
D 2 11 DC  11 66  66  DC  C   H . n 
D 2 12 DC  12 67  67  DC  C   H . n 
D 2 13 DC  13 68  68  DC  C   H . n 
D 2 14 DC  14 69  69  DC  C   H . n 
D 2 15 DA  15 70  70  DA  A   H . n 
D 2 16 DC  16 71  71  DC  C   H . n 
D 2 17 DT  17 72  72  DT  T   H . n 
D 2 18 DG  18 73  73  DG  G   H . n 
D 2 19 DC  19 74  74  DC  C   H . n 
D 2 20 DA  20 75  75  DA  A   H . n 
D 2 21 DA  21 76  76  DA  A   H . n 
E 3 1  GLN 1  319 319 GLN GLN A . n 
E 3 2  SER 2  320 320 SER SER A . n 
E 3 3  ARG 3  321 321 ARG ARG A . n 
E 3 4  GLY 4  322 322 GLY GLY A . n 
E 3 5  GLU 5  323 323 GLU GLU A . n 
E 3 6  LYS 6  324 324 LYS LYS A . n 
E 3 7  ARG 7  325 325 ARG ARG A . n 
E 3 8  THR 8  326 326 THR THR A . n 
E 3 9  ALA 9  327 327 ALA ALA A . n 
E 3 10 HIS 10 328 328 HIS HIS A . n 
E 3 11 ASN 11 329 329 ASN ASN A . n 
E 3 12 ALA 12 330 330 ALA ALA A . n 
E 3 13 ILE 13 331 331 ILE ILE A . n 
E 3 14 GLU 14 332 332 GLU GLU A . n 
E 3 15 LYS 15 333 333 LYS LYS A . n 
E 3 16 ARG 16 334 334 ARG ARG A . n 
E 3 17 TYR 17 335 335 TYR TYR A . n 
E 3 18 ARG 18 336 336 ARG ARG A . n 
E 3 19 SER 19 337 337 SER SER A . n 
E 3 20 SER 20 338 338 SER SER A . n 
E 3 21 ILE 21 339 339 ILE ILE A . n 
E 3 22 ASN 22 340 340 ASN ASN A . n 
E 3 23 ASP 23 341 341 ASP ASP A . n 
E 3 24 LYS 24 342 342 LYS LYS A . n 
E 3 25 ILE 25 343 343 ILE ILE A . n 
E 3 26 ILE 26 344 344 ILE ILE A . n 
E 3 27 GLU 27 345 345 GLU GLU A . n 
E 3 28 LEU 28 346 346 LEU LEU A . n 
E 3 29 LYS 29 347 347 LYS LYS A . n 
E 3 30 ASP 30 348 348 ASP ASP A . n 
E 3 31 LEU 31 349 349 LEU LEU A . n 
E 3 32 VAL 32 350 350 VAL VAL A . n 
E 3 33 VAL 33 351 351 VAL VAL A . n 
E 3 34 GLY 34 352 352 GLY GLY A . n 
E 3 35 THR 35 353 353 THR THR A . n 
E 3 36 GLU 36 354 354 GLU GLU A . n 
E 3 37 ALA 37 355 355 ALA ALA A . n 
E 3 38 LYS 38 356 356 LYS LYS A . n 
E 3 39 LEU 39 357 357 LEU LEU A . n 
E 3 40 ASN 40 358 358 ASN ASN A . n 
E 3 41 LYS 41 359 359 LYS LYS A . n 
E 3 42 SER 42 360 360 SER SER A . n 
E 3 43 ALA 43 361 361 ALA ALA A . n 
E 3 44 VAL 44 362 362 VAL VAL A . n 
E 3 45 LEU 45 363 363 LEU LEU A . n 
E 3 46 ARG 46 364 364 ARG ARG A . n 
E 3 47 LYS 47 365 365 LYS LYS A . n 
E 3 48 ALA 48 366 366 ALA ALA A . n 
E 3 49 ILE 49 367 367 ILE ILE A . n 
E 3 50 ASP 50 368 368 ASP ASP A . n 
E 3 51 TYR 51 369 369 TYR TYR A . n 
E 3 52 ILE 52 370 370 ILE ILE A . n 
E 3 53 ARG 53 371 371 ARG ARG A . n 
E 3 54 PHE 54 372 372 PHE PHE A . n 
E 3 55 LEU 55 373 373 LEU LEU A . n 
E 3 56 GLN 56 374 374 GLN GLN A . n 
E 3 57 HIS 57 375 375 HIS HIS A . n 
E 3 58 SER 58 376 376 SER SER A . n 
E 3 59 ASN 59 377 377 ASN ASN A . n 
E 3 60 GLN 60 378 378 GLN GLN A . n 
E 3 61 LYS 61 379 379 LYS LYS A . n 
E 3 62 LEU 62 380 380 LEU LEU A . n 
E 3 63 LYS 63 381 381 LYS LYS A . n 
E 3 64 GLN 64 382 382 GLN GLN A . n 
E 3 65 GLU 65 383 383 GLU GLU A . n 
E 3 66 ASN 66 384 384 ASN ASN A . n 
E 3 67 LEU 67 385 385 LEU LEU A . n 
E 3 68 SER 68 386 386 SER SER A . n 
E 3 69 LEU 69 387 387 LEU LEU A . n 
E 3 70 ARG 70 388 388 ARG ARG A . n 
E 3 71 THR 71 389 389 THR THR A . n 
E 3 72 ALA 72 390 390 ALA ALA A . n 
E 3 73 VAL 73 391 391 VAL VAL A . n 
E 3 74 HIS 74 392 392 HIS HIS A . n 
E 3 75 LYS 75 393 393 LYS LYS A . n 
E 3 76 SER 76 394 394 SER SER A . n 
E 3 77 LYS 77 395 395 LYS LYS A . n 
E 3 78 SER 78 396 396 SER SER A . n 
E 3 79 LEU 79 397 397 LEU LEU A . n 
E 3 80 LYS 80 398 398 LYS LYS A . n 
E 3 81 ASP 81 399 ?   ?   ?   A . n 
E 3 82 LEU 82 400 ?   ?   ?   A . n 
F 3 1  GLN 1  319 ?   ?   ?   B . n 
F 3 2  SER 2  320 320 SER SER B . n 
F 3 3  ARG 3  321 321 ARG ARG B . n 
F 3 4  GLY 4  322 322 GLY GLY B . n 
F 3 5  GLU 5  323 323 GLU GLU B . n 
F 3 6  LYS 6  324 324 LYS LYS B . n 
F 3 7  ARG 7  325 325 ARG ARG B . n 
F 3 8  THR 8  326 326 THR THR B . n 
F 3 9  ALA 9  327 327 ALA ALA B . n 
F 3 10 HIS 10 328 328 HIS HIS B . n 
F 3 11 ASN 11 329 329 ASN ASN B . n 
F 3 12 ALA 12 330 330 ALA ALA B . n 
F 3 13 ILE 13 331 331 ILE ILE B . n 
F 3 14 GLU 14 332 332 GLU GLU B . n 
F 3 15 LYS 15 333 333 LYS LYS B . n 
F 3 16 ARG 16 334 334 ARG ARG B . n 
F 3 17 TYR 17 335 335 TYR TYR B . n 
F 3 18 ARG 18 336 336 ARG ARG B . n 
F 3 19 SER 19 337 337 SER SER B . n 
F 3 20 SER 20 338 338 SER SER B . n 
F 3 21 ILE 21 339 339 ILE ILE B . n 
F 3 22 ASN 22 340 340 ASN ASN B . n 
F 3 23 ASP 23 341 341 ASP ASP B . n 
F 3 24 LYS 24 342 342 LYS LYS B . n 
F 3 25 ILE 25 343 343 ILE ILE B . n 
F 3 26 ILE 26 344 344 ILE ILE B . n 
F 3 27 GLU 27 345 345 GLU GLU B . n 
F 3 28 LEU 28 346 346 LEU LEU B . n 
F 3 29 LYS 29 347 347 LYS LYS B . n 
F 3 30 ASP 30 348 348 ASP ASP B . n 
F 3 31 LEU 31 349 349 LEU LEU B . n 
F 3 32 VAL 32 350 350 VAL VAL B . n 
F 3 33 VAL 33 351 351 VAL VAL B . n 
F 3 34 GLY 34 352 352 GLY GLY B . n 
F 3 35 THR 35 353 353 THR THR B . n 
F 3 36 GLU 36 354 354 GLU GLU B . n 
F 3 37 ALA 37 355 355 ALA ALA B . n 
F 3 38 LYS 38 356 356 LYS LYS B . n 
F 3 39 LEU 39 357 357 LEU LEU B . n 
F 3 40 ASN 40 358 358 ASN ASN B . n 
F 3 41 LYS 41 359 359 LYS LYS B . n 
F 3 42 SER 42 360 360 SER SER B . n 
F 3 43 ALA 43 361 361 ALA ALA B . n 
F 3 44 VAL 44 362 362 VAL VAL B . n 
F 3 45 LEU 45 363 363 LEU LEU B . n 
F 3 46 ARG 46 364 364 ARG ARG B . n 
F 3 47 LYS 47 365 365 LYS LYS B . n 
F 3 48 ALA 48 366 366 ALA ALA B . n 
F 3 49 ILE 49 367 367 ILE ILE B . n 
F 3 50 ASP 50 368 368 ASP ASP B . n 
F 3 51 TYR 51 369 369 TYR TYR B . n 
F 3 52 ILE 52 370 370 ILE ILE B . n 
F 3 53 ARG 53 371 371 ARG ARG B . n 
F 3 54 PHE 54 372 372 PHE PHE B . n 
F 3 55 LEU 55 373 373 LEU LEU B . n 
F 3 56 GLN 56 374 374 GLN GLN B . n 
F 3 57 HIS 57 375 375 HIS HIS B . n 
F 3 58 SER 58 376 376 SER SER B . n 
F 3 59 ASN 59 377 377 ASN ASN B . n 
F 3 60 GLN 60 378 378 GLN GLN B . n 
F 3 61 LYS 61 379 379 LYS LYS B . n 
F 3 62 LEU 62 380 380 LEU LEU B . n 
F 3 63 LYS 63 381 381 LYS LYS B . n 
F 3 64 GLN 64 382 382 GLN GLN B . n 
F 3 65 GLU 65 383 383 GLU GLU B . n 
F 3 66 ASN 66 384 384 ASN ASN B . n 
F 3 67 LEU 67 385 385 LEU LEU B . n 
F 3 68 SER 68 386 386 SER SER B . n 
F 3 69 LEU 69 387 387 LEU LEU B . n 
F 3 70 ARG 70 388 388 ARG ARG B . n 
F 3 71 THR 71 389 389 THR THR B . n 
F 3 72 ALA 72 390 390 ALA ALA B . n 
F 3 73 VAL 73 391 391 VAL VAL B . n 
F 3 74 HIS 74 392 392 HIS HIS B . n 
F 3 75 LYS 75 393 393 LYS LYS B . n 
F 3 76 SER 76 394 394 SER SER B . n 
F 3 77 LYS 77 395 ?   ?   ?   B . n 
F 3 78 SER 78 396 ?   ?   ?   B . n 
F 3 79 LEU 79 397 ?   ?   ?   B . n 
F 3 80 LYS 80 398 ?   ?   ?   B . n 
F 3 81 ASP 81 399 ?   ?   ?   B . n 
F 3 82 LEU 82 400 ?   ?   ?   B . n 
G 3 1  GLN 1  319 319 GLN GLN C . n 
G 3 2  SER 2  320 320 SER SER C . n 
G 3 3  ARG 3  321 321 ARG ARG C . n 
G 3 4  GLY 4  322 322 GLY GLY C . n 
G 3 5  GLU 5  323 323 GLU GLU C . n 
G 3 6  LYS 6  324 324 LYS LYS C . n 
G 3 7  ARG 7  325 325 ARG ARG C . n 
G 3 8  THR 8  326 326 THR THR C . n 
G 3 9  ALA 9  327 327 ALA ALA C . n 
G 3 10 HIS 10 328 328 HIS HIS C . n 
G 3 11 ASN 11 329 329 ASN ASN C . n 
G 3 12 ALA 12 330 330 ALA ALA C . n 
G 3 13 ILE 13 331 331 ILE ILE C . n 
G 3 14 GLU 14 332 332 GLU GLU C . n 
G 3 15 LYS 15 333 333 LYS LYS C . n 
G 3 16 ARG 16 334 334 ARG ARG C . n 
G 3 17 TYR 17 335 335 TYR TYR C . n 
G 3 18 ARG 18 336 336 ARG ARG C . n 
G 3 19 SER 19 337 337 SER SER C . n 
G 3 20 SER 20 338 338 SER SER C . n 
G 3 21 ILE 21 339 339 ILE ILE C . n 
G 3 22 ASN 22 340 340 ASN ASN C . n 
G 3 23 ASP 23 341 341 ASP ASP C . n 
G 3 24 LYS 24 342 342 LYS LYS C . n 
G 3 25 ILE 25 343 343 ILE ILE C . n 
G 3 26 ILE 26 344 344 ILE ILE C . n 
G 3 27 GLU 27 345 345 GLU GLU C . n 
G 3 28 LEU 28 346 346 LEU LEU C . n 
G 3 29 LYS 29 347 347 LYS LYS C . n 
G 3 30 ASP 30 348 348 ASP ASP C . n 
G 3 31 LEU 31 349 349 LEU LEU C . n 
G 3 32 VAL 32 350 350 VAL VAL C . n 
G 3 33 VAL 33 351 351 VAL VAL C . n 
G 3 34 GLY 34 352 352 GLY GLY C . n 
G 3 35 THR 35 353 353 THR THR C . n 
G 3 36 GLU 36 354 354 GLU GLU C . n 
G 3 37 ALA 37 355 355 ALA ALA C . n 
G 3 38 LYS 38 356 356 LYS LYS C . n 
G 3 39 LEU 39 357 357 LEU LEU C . n 
G 3 40 ASN 40 358 358 ASN ASN C . n 
G 3 41 LYS 41 359 359 LYS LYS C . n 
G 3 42 SER 42 360 360 SER SER C . n 
G 3 43 ALA 43 361 361 ALA ALA C . n 
G 3 44 VAL 44 362 362 VAL VAL C . n 
G 3 45 LEU 45 363 363 LEU LEU C . n 
G 3 46 ARG 46 364 364 ARG ARG C . n 
G 3 47 LYS 47 365 365 LYS LYS C . n 
G 3 48 ALA 48 366 366 ALA ALA C . n 
G 3 49 ILE 49 367 367 ILE ILE C . n 
G 3 50 ASP 50 368 368 ASP ASP C . n 
G 3 51 TYR 51 369 369 TYR TYR C . n 
G 3 52 ILE 52 370 370 ILE ILE C . n 
G 3 53 ARG 53 371 371 ARG ARG C . n 
G 3 54 PHE 54 372 372 PHE PHE C . n 
G 3 55 LEU 55 373 373 LEU LEU C . n 
G 3 56 GLN 56 374 374 GLN GLN C . n 
G 3 57 HIS 57 375 375 HIS HIS C . n 
G 3 58 SER 58 376 376 SER SER C . n 
G 3 59 ASN 59 377 377 ASN ASN C . n 
G 3 60 GLN 60 378 378 GLN GLN C . n 
G 3 61 LYS 61 379 379 LYS LYS C . n 
G 3 62 LEU 62 380 380 LEU LEU C . n 
G 3 63 LYS 63 381 381 LYS LYS C . n 
G 3 64 GLN 64 382 382 GLN GLN C . n 
G 3 65 GLU 65 383 383 GLU GLU C . n 
G 3 66 ASN 66 384 384 ASN ASN C . n 
G 3 67 LEU 67 385 385 LEU LEU C . n 
G 3 68 SER 68 386 386 SER SER C . n 
G 3 69 LEU 69 387 387 LEU LEU C . n 
G 3 70 ARG 70 388 388 ARG ARG C . n 
G 3 71 THR 71 389 389 THR THR C . n 
G 3 72 ALA 72 390 390 ALA ALA C . n 
G 3 73 VAL 73 391 391 VAL VAL C . n 
G 3 74 HIS 74 392 392 HIS HIS C . n 
G 3 75 LYS 75 393 393 LYS LYS C . n 
G 3 76 SER 76 394 394 SER SER C . n 
G 3 77 LYS 77 395 395 LYS LYS C . n 
G 3 78 SER 78 396 396 SER SER C . n 
G 3 79 LEU 79 397 397 LEU LEU C . n 
G 3 80 LYS 80 398 398 LYS LYS C . n 
G 3 81 ASP 81 399 399 ASP ASP C . n 
G 3 82 LEU 82 400 400 LEU LEU C . n 
H 3 1  GLN 1  319 319 GLN GLN D . n 
H 3 2  SER 2  320 320 SER SER D . n 
H 3 3  ARG 3  321 321 ARG ARG D . n 
H 3 4  GLY 4  322 322 GLY GLY D . n 
H 3 5  GLU 5  323 323 GLU GLU D . n 
H 3 6  LYS 6  324 324 LYS LYS D . n 
H 3 7  ARG 7  325 325 ARG ARG D . n 
H 3 8  THR 8  326 326 THR THR D . n 
H 3 9  ALA 9  327 327 ALA ALA D . n 
H 3 10 HIS 10 328 328 HIS HIS D . n 
H 3 11 ASN 11 329 329 ASN ASN D . n 
H 3 12 ALA 12 330 330 ALA ALA D . n 
H 3 13 ILE 13 331 331 ILE ILE D . n 
H 3 14 GLU 14 332 332 GLU GLU D . n 
H 3 15 LYS 15 333 333 LYS LYS D . n 
H 3 16 ARG 16 334 334 ARG ARG D . n 
H 3 17 TYR 17 335 335 TYR TYR D . n 
H 3 18 ARG 18 336 336 ARG ARG D . n 
H 3 19 SER 19 337 337 SER SER D . n 
H 3 20 SER 20 338 338 SER SER D . n 
H 3 21 ILE 21 339 339 ILE ILE D . n 
H 3 22 ASN 22 340 340 ASN ASN D . n 
H 3 23 ASP 23 341 341 ASP ASP D . n 
H 3 24 LYS 24 342 342 LYS LYS D . n 
H 3 25 ILE 25 343 343 ILE ILE D . n 
H 3 26 ILE 26 344 344 ILE ILE D . n 
H 3 27 GLU 27 345 345 GLU GLU D . n 
H 3 28 LEU 28 346 346 LEU LEU D . n 
H 3 29 LYS 29 347 347 LYS LYS D . n 
H 3 30 ASP 30 348 348 ASP ASP D . n 
H 3 31 LEU 31 349 349 LEU LEU D . n 
H 3 32 VAL 32 350 350 VAL VAL D . n 
H 3 33 VAL 33 351 351 VAL VAL D . n 
H 3 34 GLY 34 352 352 GLY GLY D . n 
H 3 35 THR 35 353 353 THR THR D . n 
H 3 36 GLU 36 354 354 GLU GLU D . n 
H 3 37 ALA 37 355 355 ALA ALA D . n 
H 3 38 LYS 38 356 356 LYS LYS D . n 
H 3 39 LEU 39 357 357 LEU LEU D . n 
H 3 40 ASN 40 358 358 ASN ASN D . n 
H 3 41 LYS 41 359 359 LYS LYS D . n 
H 3 42 SER 42 360 360 SER SER D . n 
H 3 43 ALA 43 361 361 ALA ALA D . n 
H 3 44 VAL 44 362 362 VAL VAL D . n 
H 3 45 LEU 45 363 363 LEU LEU D . n 
H 3 46 ARG 46 364 364 ARG ARG D . n 
H 3 47 LYS 47 365 365 LYS LYS D . n 
H 3 48 ALA 48 366 366 ALA ALA D . n 
H 3 49 ILE 49 367 367 ILE ILE D . n 
H 3 50 ASP 50 368 368 ASP ASP D . n 
H 3 51 TYR 51 369 369 TYR TYR D . n 
H 3 52 ILE 52 370 370 ILE ILE D . n 
H 3 53 ARG 53 371 371 ARG ARG D . n 
H 3 54 PHE 54 372 372 PHE PHE D . n 
H 3 55 LEU 55 373 373 LEU LEU D . n 
H 3 56 GLN 56 374 374 GLN GLN D . n 
H 3 57 HIS 57 375 375 HIS HIS D . n 
H 3 58 SER 58 376 376 SER SER D . n 
H 3 59 ASN 59 377 377 ASN ASN D . n 
H 3 60 GLN 60 378 378 GLN GLN D . n 
H 3 61 LYS 61 379 379 LYS LYS D . n 
H 3 62 LEU 62 380 380 LEU LEU D . n 
H 3 63 LYS 63 381 381 LYS LYS D . n 
H 3 64 GLN 64 382 382 GLN GLN D . n 
H 3 65 GLU 65 383 383 GLU GLU D . n 
H 3 66 ASN 66 384 384 ASN ASN D . n 
H 3 67 LEU 67 385 385 LEU LEU D . n 
H 3 68 SER 68 386 386 SER SER D . n 
H 3 69 LEU 69 387 387 LEU LEU D . n 
H 3 70 ARG 70 388 388 ARG ARG D . n 
H 3 71 THR 71 389 389 THR THR D . n 
H 3 72 ALA 72 390 390 ALA ALA D . n 
H 3 73 VAL 73 391 391 VAL VAL D . n 
H 3 74 HIS 74 392 392 HIS HIS D . n 
H 3 75 LYS 75 393 393 LYS LYS D . n 
H 3 76 SER 76 394 394 SER SER D . n 
H 3 77 LYS 77 395 ?   ?   ?   D . n 
H 3 78 SER 78 396 ?   ?   ?   D . n 
H 3 79 LEU 79 397 ?   ?   ?   D . n 
H 3 80 LYS 80 398 ?   ?   ?   D . n 
H 3 81 ASP 81 399 ?   ?   ?   D . n 
H 3 82 LEU 82 400 ?   ?   ?   D . n 
I 4 MG  1  2002 2002 MG  MO6 B . 
J 4 MG  1  2001 2001 MG  MO6 C . 
K 5 HOH 1  1006 1006 HOH HOH E . 
K 5 HOH 2  1007 1007 HOH HOH E . 
K 5 HOH 3  1022 1022 HOH HOH E . 
K 5 HOH 4  1028 1028 HOH HOH E . 
K 5 HOH 5  1048 1048 HOH HOH E . 
K 5 HOH 6  1052 1052 HOH HOH E . 
K 5 HOH 7  1060 1060 HOH HOH E . 
K 5 HOH 8  1064 1064 HOH HOH E . 
K 5 HOH 9  1065 1065 HOH HOH E . 
K 5 HOH 10 1087 1087 HOH HOH E . 
K 5 HOH 11 1103 1103 HOH HOH E . 
K 5 HOH 12 1116 1116 HOH HOH E . 
K 5 HOH 13 1118 1118 HOH HOH E . 
K 5 HOH 14 1119 1119 HOH HOH E . 
K 5 HOH 15 1125 1125 HOH HOH E . 
K 5 HOH 16 1158 1158 HOH HOH E . 
K 5 HOH 17 1177 1177 HOH HOH E . 
K 5 HOH 18 1204 1204 HOH HOH E . 
K 5 HOH 19 1208 1208 HOH HOH E . 
K 5 HOH 20 1211 1211 HOH HOH E . 
K 5 HOH 21 1249 1249 HOH HOH E . 
K 5 HOH 22 1278 1278 HOH HOH E . 
K 5 HOH 23 1284 1284 HOH HOH E . 
L 5 HOH 1  1009 1009 HOH HOH F . 
L 5 HOH 2  1010 1010 HOH HOH F . 
L 5 HOH 3  1012 1012 HOH HOH F . 
L 5 HOH 4  1020 1020 HOH HOH F . 
L 5 HOH 5  1030 1030 HOH HOH F . 
L 5 HOH 6  1032 1032 HOH HOH F . 
L 5 HOH 7  1036 1036 HOH HOH F . 
L 5 HOH 8  1056 1056 HOH HOH F . 
L 5 HOH 9  1075 1075 HOH HOH F . 
L 5 HOH 10 1079 1079 HOH HOH F . 
L 5 HOH 11 1082 1082 HOH HOH F . 
L 5 HOH 12 1093 1093 HOH HOH F . 
L 5 HOH 13 1095 1095 HOH HOH F . 
L 5 HOH 14 1105 1105 HOH HOH F . 
L 5 HOH 15 1106 1106 HOH HOH F . 
L 5 HOH 16 1110 1110 HOH HOH F . 
L 5 HOH 17 1129 1129 HOH HOH F . 
L 5 HOH 18 1145 1145 HOH HOH F . 
L 5 HOH 19 1148 1148 HOH HOH F . 
L 5 HOH 20 1154 1154 HOH HOH F . 
L 5 HOH 21 1155 1155 HOH HOH F . 
L 5 HOH 22 1169 1169 HOH HOH F . 
L 5 HOH 23 1183 1183 HOH HOH F . 
L 5 HOH 24 1187 1187 HOH HOH F . 
L 5 HOH 25 1202 1202 HOH HOH F . 
L 5 HOH 26 1203 1203 HOH HOH F . 
L 5 HOH 27 1214 1214 HOH HOH F . 
L 5 HOH 28 1215 1215 HOH HOH F . 
L 5 HOH 29 1237 1237 HOH HOH F . 
L 5 HOH 30 1281 1281 HOH HOH F . 
L 5 HOH 31 1282 1282 HOH HOH F . 
L 5 HOH 32 1283 1283 HOH HOH F . 
L 5 HOH 33 1287 1287 HOH HOH F . 
M 5 HOH 1  1002 1002 HOH HOH G . 
M 5 HOH 2  1005 1005 HOH HOH G . 
M 5 HOH 3  1014 1014 HOH HOH G . 
M 5 HOH 4  1016 1016 HOH HOH G . 
M 5 HOH 5  1027 1027 HOH HOH G . 
M 5 HOH 6  1031 1031 HOH HOH G . 
M 5 HOH 7  1040 1040 HOH HOH G . 
M 5 HOH 8  1053 1053 HOH HOH G . 
M 5 HOH 9  1067 1067 HOH HOH G . 
M 5 HOH 10 1070 1070 HOH HOH G . 
M 5 HOH 11 1076 1076 HOH HOH G . 
M 5 HOH 12 1084 1084 HOH HOH G . 
M 5 HOH 13 1108 1108 HOH HOH G . 
M 5 HOH 14 1111 1111 HOH HOH G . 
M 5 HOH 15 1117 1117 HOH HOH G . 
M 5 HOH 16 1120 1120 HOH HOH G . 
M 5 HOH 17 1147 1147 HOH HOH G . 
M 5 HOH 18 1166 1166 HOH HOH G . 
M 5 HOH 19 1170 1170 HOH HOH G . 
M 5 HOH 20 1185 1185 HOH HOH G . 
M 5 HOH 21 1186 1186 HOH HOH G . 
M 5 HOH 22 1200 1200 HOH HOH G . 
M 5 HOH 23 1201 1201 HOH HOH G . 
M 5 HOH 24 1209 1209 HOH HOH G . 
M 5 HOH 25 1239 1239 HOH HOH G . 
M 5 HOH 26 1279 1279 HOH HOH G . 
M 5 HOH 27 1280 1280 HOH HOH G . 
N 5 HOH 1  1004 1004 HOH HOH H . 
N 5 HOH 2  1008 1008 HOH HOH H . 
N 5 HOH 3  1013 1013 HOH HOH H . 
N 5 HOH 4  1015 1015 HOH HOH H . 
N 5 HOH 5  1021 1021 HOH HOH H . 
N 5 HOH 6  1025 1025 HOH HOH H . 
N 5 HOH 7  1037 1037 HOH HOH H . 
N 5 HOH 8  1039 1039 HOH HOH H . 
N 5 HOH 9  1050 1050 HOH HOH H . 
N 5 HOH 10 1054 1054 HOH HOH H . 
N 5 HOH 11 1069 1069 HOH HOH H . 
N 5 HOH 12 1072 1072 HOH HOH H . 
N 5 HOH 13 1073 1073 HOH HOH H . 
N 5 HOH 14 1086 1086 HOH HOH H . 
N 5 HOH 15 1096 1096 HOH HOH H . 
N 5 HOH 16 1099 1099 HOH HOH H . 
N 5 HOH 17 1102 1102 HOH HOH H . 
N 5 HOH 18 1109 1109 HOH HOH H . 
N 5 HOH 19 1113 1113 HOH HOH H . 
N 5 HOH 20 1128 1128 HOH HOH H . 
N 5 HOH 21 1140 1140 HOH HOH H . 
N 5 HOH 22 1146 1146 HOH HOH H . 
N 5 HOH 23 1159 1159 HOH HOH H . 
N 5 HOH 24 1160 1160 HOH HOH H . 
N 5 HOH 25 1163 1163 HOH HOH H . 
N 5 HOH 26 1165 1165 HOH HOH H . 
N 5 HOH 27 1173 1173 HOH HOH H . 
N 5 HOH 28 1178 1178 HOH HOH H . 
N 5 HOH 29 1206 1206 HOH HOH H . 
N 5 HOH 30 1218 1218 HOH HOH H . 
N 5 HOH 31 1220 1220 HOH HOH H . 
N 5 HOH 32 1228 1228 HOH HOH H . 
N 5 HOH 33 1253 1253 HOH HOH H . 
N 5 HOH 34 1258 1258 HOH HOH H . 
N 5 HOH 35 1260 1260 HOH HOH H . 
N 5 HOH 36 1263 1263 HOH HOH H . 
N 5 HOH 37 1265 1265 HOH HOH H . 
N 5 HOH 38 1266 1266 HOH HOH H . 
N 5 HOH 39 1285 1285 HOH HOH H . 
N 5 HOH 40 1286 1286 HOH HOH H . 
O 5 HOH 1  1003 1003 HOH HOH A . 
O 5 HOH 2  1018 1018 HOH HOH A . 
O 5 HOH 3  1029 1029 HOH HOH A . 
O 5 HOH 4  1034 1034 HOH HOH A . 
O 5 HOH 5  1041 1041 HOH HOH A . 
O 5 HOH 6  1043 1043 HOH HOH A . 
O 5 HOH 7  1051 1051 HOH HOH A . 
O 5 HOH 8  1057 1057 HOH HOH A . 
O 5 HOH 9  1061 1061 HOH HOH A . 
O 5 HOH 10 1062 1062 HOH HOH A . 
O 5 HOH 11 1094 1094 HOH HOH A . 
O 5 HOH 12 1104 1104 HOH HOH A . 
O 5 HOH 13 1126 1126 HOH HOH A . 
O 5 HOH 14 1127 1127 HOH HOH A . 
O 5 HOH 15 1135 1135 HOH HOH A . 
O 5 HOH 16 1137 1137 HOH HOH A . 
O 5 HOH 17 1150 1150 HOH HOH A . 
O 5 HOH 18 1152 1152 HOH HOH A . 
O 5 HOH 19 1153 1153 HOH HOH A . 
O 5 HOH 20 1161 1161 HOH HOH A . 
O 5 HOH 21 1168 1168 HOH HOH A . 
O 5 HOH 22 1184 1184 HOH HOH A . 
O 5 HOH 23 1188 1188 HOH HOH A . 
O 5 HOH 24 1189 1189 HOH HOH A . 
O 5 HOH 25 1190 1190 HOH HOH A . 
O 5 HOH 26 1191 1191 HOH HOH A . 
O 5 HOH 27 1194 1194 HOH HOH A . 
O 5 HOH 28 1195 1195 HOH HOH A . 
O 5 HOH 29 1196 1196 HOH HOH A . 
O 5 HOH 30 1197 1197 HOH HOH A . 
O 5 HOH 31 1198 1198 HOH HOH A . 
O 5 HOH 32 1199 1199 HOH HOH A . 
O 5 HOH 33 1212 1212 HOH HOH A . 
O 5 HOH 34 1213 1213 HOH HOH A . 
O 5 HOH 35 1216 1216 HOH HOH A . 
O 5 HOH 36 1217 1217 HOH HOH A . 
O 5 HOH 37 1219 1219 HOH HOH A . 
O 5 HOH 38 1225 1225 HOH HOH A . 
O 5 HOH 39 1227 1227 HOH HOH A . 
O 5 HOH 40 1229 1229 HOH HOH A . 
O 5 HOH 41 1230 1230 HOH HOH A . 
O 5 HOH 42 1233 1233 HOH HOH A . 
O 5 HOH 43 1234 1234 HOH HOH A . 
O 5 HOH 44 1235 1235 HOH HOH A . 
O 5 HOH 45 1264 1264 HOH HOH A . 
O 5 HOH 46 2009 2002 HOH MO6 A . 
O 5 HOH 47 2012 2002 HOH MO6 A . 
O 5 HOH 48 2013 2002 HOH MO6 A . 
P 5 HOH 1  1017 1017 HOH HOH B . 
P 5 HOH 2  1035 1035 HOH HOH B . 
P 5 HOH 3  1042 1042 HOH HOH B . 
P 5 HOH 4  1044 1044 HOH HOH B . 
P 5 HOH 5  1045 1045 HOH HOH B . 
P 5 HOH 6  1046 1046 HOH HOH B . 
P 5 HOH 7  1047 1047 HOH HOH B . 
P 5 HOH 8  1059 1059 HOH HOH B . 
P 5 HOH 9  1080 1080 HOH HOH B . 
P 5 HOH 10 1097 1097 HOH HOH B . 
P 5 HOH 11 1098 1098 HOH HOH B . 
P 5 HOH 12 1107 1107 HOH HOH B . 
P 5 HOH 13 1121 1121 HOH HOH B . 
P 5 HOH 14 1133 1133 HOH HOH B . 
P 5 HOH 15 1142 1142 HOH HOH B . 
P 5 HOH 16 1149 1149 HOH HOH B . 
P 5 HOH 17 1151 1151 HOH HOH B . 
P 5 HOH 18 1156 1156 HOH HOH B . 
P 5 HOH 19 1157 1157 HOH HOH B . 
P 5 HOH 20 1167 1167 HOH HOH B . 
P 5 HOH 21 1171 1171 HOH HOH B . 
P 5 HOH 22 1176 1176 HOH HOH B . 
P 5 HOH 23 1192 1192 HOH HOH B . 
P 5 HOH 24 1193 1193 HOH HOH B . 
P 5 HOH 25 1221 1221 HOH HOH B . 
P 5 HOH 26 1222 1222 HOH HOH B . 
P 5 HOH 27 1223 1223 HOH HOH B . 
P 5 HOH 28 1224 1224 HOH HOH B . 
P 5 HOH 29 1231 1231 HOH HOH B . 
P 5 HOH 30 1236 1236 HOH HOH B . 
P 5 HOH 31 1238 1238 HOH HOH B . 
P 5 HOH 32 1244 1244 HOH HOH B . 
P 5 HOH 33 1245 1245 HOH HOH B . 
P 5 HOH 34 1246 1246 HOH HOH B . 
P 5 HOH 35 1261 1261 HOH HOH B . 
P 5 HOH 36 2010 2002 HOH MO6 B . 
P 5 HOH 37 2011 2002 HOH MO6 B . 
P 5 HOH 38 2014 2002 HOH MO6 B . 
Q 5 HOH 1  1001 1001 HOH HOH C . 
Q 5 HOH 2  1011 1011 HOH HOH C . 
Q 5 HOH 3  1023 1023 HOH HOH C . 
Q 5 HOH 4  1026 1026 HOH HOH C . 
Q 5 HOH 5  1033 1033 HOH HOH C . 
Q 5 HOH 6  1055 1055 HOH HOH C . 
Q 5 HOH 7  1068 1068 HOH HOH C . 
Q 5 HOH 8  1071 1071 HOH HOH C . 
Q 5 HOH 9  1074 1074 HOH HOH C . 
Q 5 HOH 10 1077 1077 HOH HOH C . 
Q 5 HOH 11 1081 1081 HOH HOH C . 
Q 5 HOH 12 1083 1083 HOH HOH C . 
Q 5 HOH 13 1085 1085 HOH HOH C . 
Q 5 HOH 14 1089 1089 HOH HOH C . 
Q 5 HOH 15 1090 1090 HOH HOH C . 
Q 5 HOH 16 1091 1091 HOH HOH C . 
Q 5 HOH 17 1092 1092 HOH HOH C . 
Q 5 HOH 18 1100 1100 HOH HOH C . 
Q 5 HOH 19 1101 1101 HOH HOH C . 
Q 5 HOH 20 1112 1112 HOH HOH C . 
Q 5 HOH 21 1115 1115 HOH HOH C . 
Q 5 HOH 22 1123 1123 HOH HOH C . 
Q 5 HOH 23 1130 1130 HOH HOH C . 
Q 5 HOH 24 1131 1131 HOH HOH C . 
Q 5 HOH 25 1134 1134 HOH HOH C . 
Q 5 HOH 26 1136 1136 HOH HOH C . 
Q 5 HOH 27 1139 1139 HOH HOH C . 
Q 5 HOH 28 1162 1162 HOH HOH C . 
Q 5 HOH 29 1174 1174 HOH HOH C . 
Q 5 HOH 30 1175 1175 HOH HOH C . 
Q 5 HOH 31 1205 1205 HOH HOH C . 
Q 5 HOH 32 1207 1207 HOH HOH C . 
Q 5 HOH 33 1240 1240 HOH HOH C . 
Q 5 HOH 34 1241 1241 HOH HOH C . 
Q 5 HOH 35 1242 1242 HOH HOH C . 
Q 5 HOH 36 1243 1243 HOH HOH C . 
Q 5 HOH 37 1247 1247 HOH HOH C . 
Q 5 HOH 38 1248 1248 HOH HOH C . 
Q 5 HOH 39 1250 1250 HOH HOH C . 
Q 5 HOH 40 1251 1251 HOH HOH C . 
Q 5 HOH 41 1254 1254 HOH HOH C . 
Q 5 HOH 42 1255 1255 HOH HOH C . 
Q 5 HOH 43 1256 1256 HOH HOH C . 
Q 5 HOH 44 1257 1257 HOH HOH C . 
Q 5 HOH 45 1262 1262 HOH HOH C . 
Q 5 HOH 46 1267 1267 HOH HOH C . 
Q 5 HOH 47 1269 1269 HOH HOH C . 
Q 5 HOH 48 1275 1275 HOH HOH C . 
R 5 HOH 1  1019 1019 HOH HOH D . 
R 5 HOH 2  1024 1024 HOH HOH D . 
R 5 HOH 3  1038 1038 HOH HOH D . 
R 5 HOH 4  1049 1049 HOH HOH D . 
R 5 HOH 5  1058 1058 HOH HOH D . 
R 5 HOH 6  1063 1063 HOH HOH D . 
R 5 HOH 7  1066 1066 HOH HOH D . 
R 5 HOH 8  1078 1078 HOH HOH D . 
R 5 HOH 9  1088 1088 HOH HOH D . 
R 5 HOH 10 1114 1114 HOH HOH D . 
R 5 HOH 11 1122 1122 HOH HOH D . 
R 5 HOH 12 1124 1124 HOH HOH D . 
R 5 HOH 13 1132 1132 HOH HOH D . 
R 5 HOH 14 1138 1138 HOH HOH D . 
R 5 HOH 15 1141 1141 HOH HOH D . 
R 5 HOH 16 1143 1143 HOH HOH D . 
R 5 HOH 17 1144 1144 HOH HOH D . 
R 5 HOH 18 1164 1164 HOH HOH D . 
R 5 HOH 19 1172 1172 HOH HOH D . 
R 5 HOH 20 1179 1179 HOH HOH D . 
R 5 HOH 21 1180 1180 HOH HOH D . 
R 5 HOH 22 1181 1181 HOH HOH D . 
R 5 HOH 23 1182 1182 HOH HOH D . 
R 5 HOH 24 1210 1210 HOH HOH D . 
R 5 HOH 25 1226 1226 HOH HOH D . 
R 5 HOH 26 1232 1232 HOH HOH D . 
R 5 HOH 27 1252 1252 HOH HOH D . 
R 5 HOH 28 1259 1259 HOH HOH D . 
R 5 HOH 29 1268 1268 HOH HOH D . 
R 5 HOH 30 1270 1270 HOH HOH D . 
R 5 HOH 31 1271 1271 HOH HOH D . 
R 5 HOH 32 1272 1272 HOH HOH D . 
R 5 HOH 33 1273 1273 HOH HOH D . 
R 5 HOH 34 1274 1274 HOH HOH D . 
R 5 HOH 35 1276 1276 HOH HOH D . 
R 5 HOH 36 1277 1277 HOH HOH D . 
R 5 HOH 37 2003 2001 HOH MO6 D . 
R 5 HOH 38 2004 2001 HOH MO6 D . 
R 5 HOH 39 2005 2001 HOH MO6 D . 
R 5 HOH 40 2006 2001 HOH MO6 D . 
R 5 HOH 41 2007 2001 HOH MO6 D . 
R 5 HOH 42 2008 2001 HOH MO6 D . 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   octameric 
_pdbx_struct_assembly.oligomeric_count     8 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1  O ? O HOH . ? A HOH 2009 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? O HOH . ? A HOH 2012 ? 1_555 86.6  ? 
2  O ? O HOH . ? A HOH 2009 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? O HOH . ? A HOH 2013 ? 1_555 88.2  ? 
3  O ? O HOH . ? A HOH 2012 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? O HOH . ? A HOH 2013 ? 1_555 81.6  ? 
4  O ? O HOH . ? A HOH 2009 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2010 ? 1_555 176.7 ? 
5  O ? O HOH . ? A HOH 2012 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2010 ? 1_555 94.6  ? 
6  O ? O HOH . ? A HOH 2013 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2010 ? 1_555 88.9  ? 
7  O ? O HOH . ? A HOH 2009 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2011 ? 1_555 89.4  ? 
8  O ? O HOH . ? A HOH 2012 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2011 ? 1_555 170.2 ? 
9  O ? O HOH . ? A HOH 2013 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2011 ? 1_555 89.3  ? 
10 O ? P HOH . ? B HOH 2010 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2011 ? 1_555 89.0  ? 
11 O ? O HOH . ? A HOH 2009 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2014 ? 1_555 90.4  ? 
12 O ? O HOH . ? A HOH 2012 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2014 ? 1_555 96.0  ? 
13 O ? O HOH . ? A HOH 2013 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2014 ? 1_555 177.3 ? 
14 O ? P HOH . ? B HOH 2010 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2014 ? 1_555 92.6  ? 
15 O ? P HOH . ? B HOH 2011 ? 1_555 MG ? I MG . ? B MG 2002 ? 1_555 O ? P HOH . ? B HOH 2014 ? 1_555 93.0  ? 
16 O ? R HOH . ? D HOH 2003 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2004 ? 1_555 176.8 ? 
17 O ? R HOH . ? D HOH 2003 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2005 ? 1_555 89.4  ? 
18 O ? R HOH . ? D HOH 2004 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2005 ? 1_555 89.0  ? 
19 O ? R HOH . ? D HOH 2003 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2006 ? 1_555 86.5  ? 
20 O ? R HOH . ? D HOH 2004 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2006 ? 1_555 94.6  ? 
21 O ? R HOH . ? D HOH 2005 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2006 ? 1_555 170.2 ? 
22 O ? R HOH . ? D HOH 2003 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2007 ? 1_555 88.2  ? 
23 O ? R HOH . ? D HOH 2004 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2007 ? 1_555 89.0  ? 
24 O ? R HOH . ? D HOH 2005 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2007 ? 1_555 89.3  ? 
25 O ? R HOH . ? D HOH 2006 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2007 ? 1_555 81.6  ? 
26 O ? R HOH . ? D HOH 2003 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2008 ? 1_555 90.4  ? 
27 O ? R HOH . ? D HOH 2004 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2008 ? 1_555 92.6  ? 
28 O ? R HOH . ? D HOH 2005 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2008 ? 1_555 93.0  ? 
29 O ? R HOH . ? D HOH 2006 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2008 ? 1_555 96.0  ? 
30 O ? R HOH . ? D HOH 2007 ? 1_555 MG ? J MG . ? C MG 2001 ? 1_555 O ? R HOH . ? D HOH 2008 ? 1_555 177.3 ? 
1 'Structure model' 1 0 1998-07-10 
2 'Structure model' 1 1 2008-05-22 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2021-02-03 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Database references'       
4 4 'Structure model' 'Derived calculations'      
5 4 'Structure model' 'Structure summary'         
1 4 'Structure model' audit_author           
2 4 'Structure model' citation_author        
3 4 'Structure model' pdbx_struct_conn_angle 
4 4 'Structure model' struct_conn            
5 4 'Structure model' struct_site            
1  4 'Structure model' '_audit_author.identifier_ORCID'              
2  4 'Structure model' '_citation_author.identifier_ORCID'           
3  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_asym_id'  
4  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id'   
5  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_asym_id' 
6  4 'Structure model' '_pdbx_struct_conn_angle.ptnr2_auth_asym_id'  
7  4 'Structure model' '_pdbx_struct_conn_angle.ptnr2_auth_seq_id'   
8  4 'Structure model' '_pdbx_struct_conn_angle.ptnr2_label_asym_id' 
9  4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_asym_id'  
10 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id'   
11 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_asym_id' 
12 4 'Structure model' '_pdbx_struct_conn_angle.value'               
13 4 'Structure model' '_struct_conn.pdbx_dist_value'                
14 4 'Structure model' '_struct_conn.ptnr1_auth_asym_id'             
15 4 'Structure model' '_struct_conn.ptnr1_auth_comp_id'             
16 4 'Structure model' '_struct_conn.ptnr1_auth_seq_id'              
17 4 'Structure model' '_struct_conn.ptnr1_label_asym_id'            
18 4 'Structure model' '_struct_conn.ptnr1_label_atom_id'            
19 4 'Structure model' '_struct_conn.ptnr1_label_comp_id'            
20 4 'Structure model' '_struct_conn.ptnr2_auth_asym_id'             
21 4 'Structure model' '_struct_conn.ptnr2_auth_comp_id'             
22 4 'Structure model' '_struct_conn.ptnr2_auth_seq_id'              
23 4 'Structure model' '_struct_conn.ptnr2_label_asym_id'            
24 4 'Structure model' '_struct_conn.ptnr2_label_atom_id'            
25 4 'Structure model' '_struct_conn.ptnr2_label_comp_id'            
26 4 'Structure model' '_struct_site.pdbx_auth_asym_id'              
27 4 'Structure model' '_struct_site.pdbx_auth_comp_id'              
28 4 'Structure model' '_struct_site.pdbx_auth_seq_id'               
AMoRE     phasing          .   ? 1 
X-PLOR    refinement       3.1 ? 2 
DENZO     'data reduction' .   ? 3 
SCALEPACK 'data scaling'   .   ? 4 
1 1 "C5'" G DT 40 ? ? "C4'" G DT 40 ? ? 1.564 1.512 0.052 0.007 N 
2 1 C5    G DT 45 ? ? C7    G DT 45 ? ? 1.534 1.496 0.038 0.006 N 
1  1 "O4'" E DT 2  ? ? "C1'" E DT 2  ? ? N1    E DT 2  ? ? 110.61 108.30 2.31   0.30 N 
2  1 "C5'" E DC 4  ? ? "C4'" E DC 4  ? ? "O4'" E DC 4  ? ? 117.63 109.80 7.83   1.10 N 
3  1 "O4'" E DC 4  ? ? "C1'" E DC 4  ? ? N1    E DC 4  ? ? 113.12 108.30 4.82   0.30 N 
4  1 "C3'" E DC 4  ? ? "O3'" E DC 4  ? ? P     E DA 5  ? ? 111.86 119.70 -7.84  1.20 Y 
5  1 "O4'" E DT 7  ? ? "C1'" E DT 7  ? ? N1    E DT 7  ? ? 110.61 108.30 2.31   0.30 N 
6  1 C4    E DT 7  ? ? C5    E DT 7  ? ? C6    E DT 7  ? ? 121.61 118.00 3.61   0.60 N 
7  1 "O4'" E DG 8  ? ? "C1'" E DG 8  ? ? N9    E DG 8  ? ? 111.02 108.30 2.72   0.30 N 
8  1 "O4'" E DG 9  ? ? "C1'" E DG 9  ? ? N9    E DG 9  ? ? 110.44 108.30 2.14   0.30 N 
9  1 P     E DG 10 ? ? "O5'" E DG 10 ? ? "C5'" E DG 10 ? ? 109.38 120.90 -11.52 1.60 N 
10 1 "O4'" E DG 10 ? ? "C1'" E DG 10 ? ? N9    E DG 10 ? ? 111.41 108.30 3.11   0.30 N 
11 1 "O4'" E DT 15 ? ? "C1'" E DT 15 ? ? N1    E DT 15 ? ? 110.89 108.30 2.59   0.30 N 
12 1 C6    E DT 15 ? ? C5    E DT 15 ? ? C7    E DT 15 ? ? 118.23 122.90 -4.67  0.60 N 
13 1 "O4'" F DC 18 ? ? "C1'" F DC 18 ? ? N1    F DC 18 ? ? 114.04 108.30 5.74   0.30 N 
14 1 "O4'" F DA 22 ? ? "C1'" F DA 22 ? ? N9    F DA 22 ? ? 114.99 108.30 6.69   0.30 N 
15 1 C6    F DT 25 ? ? C5    F DT 25 ? ? C7    F DT 25 ? ? 119.13 122.90 -3.77  0.60 N 
16 1 "O4'" F DC 26 ? ? "C1'" F DC 26 ? ? N1    F DC 26 ? ? 111.25 108.30 2.95   0.30 N 
17 1 "O4'" F DC 28 ? ? "C1'" F DC 28 ? ? N1    F DC 28 ? ? 111.65 108.30 3.35   0.30 N 
18 1 P     F DC 29 ? ? "O5'" F DC 29 ? ? "C5'" F DC 29 ? ? 109.93 120.90 -10.97 1.60 N 
19 1 P     F DC 30 ? ? "O5'" F DC 30 ? ? "C5'" F DC 30 ? ? 110.45 120.90 -10.45 1.60 N 
20 1 "O4'" F DC 30 ? ? "C1'" F DC 30 ? ? N1    F DC 30 ? ? 110.85 108.30 2.55   0.30 N 
21 1 "O4'" F DC 33 ? ? "C1'" F DC 33 ? ? N1    F DC 33 ? ? 113.05 108.30 4.75   0.30 N 
22 1 "O4'" F DT 34 ? ? "C1'" F DT 34 ? ? N1    F DT 34 ? ? 110.38 108.30 2.08   0.30 N 
23 1 "C3'" F DG 35 ? ? "C2'" F DG 35 ? ? "C1'" F DG 35 ? ? 97.49  102.40 -4.91  0.80 N 
24 1 "O4'" F DG 35 ? ? "C1'" F DG 35 ? ? N9    F DG 35 ? ? 112.76 108.30 4.46   0.30 N 
25 1 "O4'" F DC 36 ? ? "C1'" F DC 36 ? ? N1    F DC 36 ? ? 112.68 108.30 4.38   0.30 N 
26 1 "O4'" F DA 38 ? ? "C1'" F DA 38 ? ? N9    F DA 38 ? ? 114.85 108.30 6.55   0.30 N 
27 1 "O4'" G DG 41 ? ? "C1'" G DG 41 ? ? N9    G DG 41 ? ? 111.74 108.30 3.44   0.30 N 
28 1 "C3'" G DG 41 ? ? "O3'" G DG 41 ? ? P     G DC 42 ? ? 126.96 119.70 7.26   1.20 Y 
29 1 "O4'" G DT 45 ? ? "C1'" G DT 45 ? ? "C2'" G DT 45 ? ? 100.23 105.90 -5.67  0.80 N 
30 1 "O4'" G DG 48 ? ? "C1'" G DG 48 ? ? N9    G DG 48 ? ? 111.82 108.30 3.52   0.30 N 
31 1 "O4'" H DC 56 ? ? "C1'" H DC 56 ? ? N1    H DC 56 ? ? 113.48 108.30 5.18   0.30 N 
32 1 "O4'" H DA 57 ? ? "C1'" H DA 57 ? ? N9    H DA 57 ? ? 111.16 108.30 2.86   0.30 N 
33 1 "O4'" H DT 58 ? ? "C1'" H DT 58 ? ? N1    H DT 58 ? ? 112.10 108.30 3.80   0.30 N 
34 1 C6    H DT 58 ? ? C5    H DT 58 ? ? C7    H DT 58 ? ? 118.40 122.90 -4.50  0.60 N 
35 1 "O4'" H DA 60 ? ? "C1'" H DA 60 ? ? N9    H DA 60 ? ? 113.28 108.30 4.98   0.30 N 
36 1 "O4'" H DT 63 ? ? "C1'" H DT 63 ? ? "C2'" H DT 63 ? ? 100.19 105.90 -5.71  0.80 N 
37 1 "O4'" H DT 63 ? ? "C1'" H DT 63 ? ? N1    H DT 63 ? ? 110.12 108.30 1.82   0.30 N 
38 1 P     H DC 64 ? ? "O5'" H DC 64 ? ? "C5'" H DC 64 ? ? 109.72 120.90 -11.18 1.60 N 
39 1 "O4'" H DC 64 ? ? "C1'" H DC 64 ? ? N1    H DC 64 ? ? 111.16 108.30 2.86   0.30 N 
40 1 P     H DC 68 ? ? "O5'" H DC 68 ? ? "C5'" H DC 68 ? ? 109.80 120.90 -11.10 1.60 N 
41 1 "O4'" H DC 69 ? ? "C1'" H DC 69 ? ? N1    H DC 69 ? ? 110.10 108.30 1.80   0.30 N 
42 1 "O4'" H DC 71 ? ? "C1'" H DC 71 ? ? N1    H DC 71 ? ? 111.48 108.30 3.18   0.30 N 
43 1 "C3'" H DT 72 ? ? "C2'" H DT 72 ? ? "C1'" H DT 72 ? ? 96.44  102.40 -5.96  0.80 N 
44 1 "O4'" H DT 72 ? ? "C1'" H DT 72 ? ? N1    H DT 72 ? ? 110.50 108.30 2.20   0.30 N 
45 1 "C3'" H DG 73 ? ? "C2'" H DG 73 ? ? "C1'" H DG 73 ? ? 97.44  102.40 -4.96  0.80 N 
46 1 "O4'" H DG 73 ? ? "C1'" H DG 73 ? ? N9    H DG 73 ? ? 112.05 108.30 3.75   0.30 N 
47 1 "O4'" H DC 74 ? ? "C1'" H DC 74 ? ? N1    H DC 74 ? ? 111.27 108.30 2.97   0.30 N 
48 1 "O4'" H DA 76 ? ? "C1'" H DA 76 ? ? N9    H DA 76 ? ? 112.90 108.30 4.60   0.30 N 
1 1 SER A 394 ? ? -61.31  9.53   
2 1 LYS A 395 ? ? -147.69 -52.59 
3 1 SER A 396 ? ? -55.84  14.85  
4 1 VAL B 351 ? ? -142.57 -1.27  
5 1 LYS B 393 ? ? -78.58  40.02  
6 1 LYS C 398 ? ? -23.84  128.81 
7 1 ASP C 399 ? ? -54.81  102.98 
1  1 DT E 1  ? ? 0.098 'SIDE CHAIN' 
2  1 DG E 3  ? ? 0.103 'SIDE CHAIN' 
3  1 DG E 11 ? ? 0.054 'SIDE CHAIN' 
4  1 DC F 18 ? ? 0.098 'SIDE CHAIN' 
5  1 DA F 19 ? ? 0.063 'SIDE CHAIN' 
6  1 DA F 22 ? ? 0.055 'SIDE CHAIN' 
7  1 DC F 33 ? ? 0.083 'SIDE CHAIN' 
8  1 DT G 39 ? ? 0.076 'SIDE CHAIN' 
9  1 DG G 41 ? ? 0.060 'SIDE CHAIN' 
10 1 DA G 43 ? ? 0.050 'SIDE CHAIN' 
11 1 DG G 46 ? ? 0.062 'SIDE CHAIN' 
12 1 DC H 56 ? ? 0.100 'SIDE CHAIN' 
13 1 DA H 60 ? ? 0.076 'SIDE CHAIN' 
14 1 DC H 66 ? ? 0.072 'SIDE CHAIN' 
15 1 DG H 73 ? ? 0.058 'SIDE CHAIN' 
1   1 Y 1 A ARG 321 ? CG  ? E ARG 3  CG  
2   1 Y 1 A ARG 321 ? CD  ? E ARG 3  CD  
3   1 Y 1 A ARG 321 ? NE  ? E ARG 3  NE  
4   1 Y 1 A ARG 321 ? CZ  ? E ARG 3  CZ  
5   1 Y 1 A ARG 321 ? NH1 ? E ARG 3  NH1 
6   1 Y 1 A ARG 321 ? NH2 ? E ARG 3  NH2 
7   1 Y 1 A THR 353 ? OG1 ? E THR 35 OG1 
8   1 Y 1 A THR 353 ? CG2 ? E THR 35 CG2 
9   1 Y 1 A GLU 354 ? CG  ? E GLU 36 CG  
10  1 Y 1 A GLU 354 ? CD  ? E GLU 36 CD  
11  1 Y 1 A GLU 354 ? OE1 ? E GLU 36 OE1 
12  1 Y 1 A GLU 354 ? OE2 ? E GLU 36 OE2 
13  1 Y 1 A LYS 356 ? CG  ? E LYS 38 CG  
14  1 Y 1 A LYS 356 ? CD  ? E LYS 38 CD  
15  1 Y 1 A LYS 356 ? CE  ? E LYS 38 CE  
16  1 Y 1 A LYS 356 ? NZ  ? E LYS 38 NZ  
17  1 Y 1 A LYS 393 ? CG  ? E LYS 75 CG  
18  1 Y 1 A LYS 393 ? CD  ? E LYS 75 CD  
19  1 Y 1 A LYS 393 ? CE  ? E LYS 75 CE  
20  1 Y 1 A LYS 393 ? NZ  ? E LYS 75 NZ  
21  1 Y 1 A SER 394 ? OG  ? E SER 76 OG  
22  1 Y 1 A SER 396 ? OG  ? E SER 78 OG  
23  1 Y 1 A LEU 397 ? CG  ? E LEU 79 CG  
24  1 Y 1 A LEU 397 ? CD1 ? E LEU 79 CD1 
25  1 Y 1 A LEU 397 ? CD2 ? E LEU 79 CD2 
26  1 Y 1 A LYS 398 ? CG  ? E LYS 80 CG  
27  1 Y 1 A LYS 398 ? CD  ? E LYS 80 CD  
28  1 Y 1 A LYS 398 ? CE  ? E LYS 80 CE  
29  1 Y 1 A LYS 398 ? NZ  ? E LYS 80 NZ  
30  1 Y 1 B ARG 321 ? CG  ? F ARG 3  CG  
31  1 Y 1 B ARG 321 ? CD  ? F ARG 3  CD  
32  1 Y 1 B ARG 321 ? NE  ? F ARG 3  NE  
33  1 Y 1 B ARG 321 ? CZ  ? F ARG 3  CZ  
34  1 Y 1 B ARG 321 ? NH1 ? F ARG 3  NH1 
35  1 Y 1 B ARG 321 ? NH2 ? F ARG 3  NH2 
36  1 Y 1 B LYS 324 ? CG  ? F LYS 6  CG  
37  1 Y 1 B LYS 324 ? CD  ? F LYS 6  CD  
38  1 Y 1 B LYS 324 ? CE  ? F LYS 6  CE  
39  1 Y 1 B LYS 324 ? NZ  ? F LYS 6  NZ  
40  1 Y 1 B THR 389 ? OG1 ? F THR 71 OG1 
41  1 Y 1 B THR 389 ? CG2 ? F THR 71 CG2 
42  1 Y 1 B HIS 392 ? CG  ? F HIS 74 CG  
43  1 Y 1 B HIS 392 ? ND1 ? F HIS 74 ND1 
44  1 Y 1 B HIS 392 ? CD2 ? F HIS 74 CD2 
45  1 Y 1 B HIS 392 ? CE1 ? F HIS 74 CE1 
46  1 Y 1 B HIS 392 ? NE2 ? F HIS 74 NE2 
47  1 Y 1 B LYS 393 ? CG  ? F LYS 75 CG  
48  1 Y 1 B LYS 393 ? CD  ? F LYS 75 CD  
49  1 Y 1 B LYS 393 ? CE  ? F LYS 75 CE  
50  1 Y 1 B LYS 393 ? NZ  ? F LYS 75 NZ  
51  1 Y 1 B SER 394 ? OG  ? F SER 76 OG  
52  1 Y 1 C ARG 321 ? CG  ? G ARG 3  CG  
53  1 Y 1 C ARG 321 ? CD  ? G ARG 3  CD  
54  1 Y 1 C ARG 321 ? NE  ? G ARG 3  NE  
55  1 Y 1 C ARG 321 ? CZ  ? G ARG 3  CZ  
56  1 Y 1 C ARG 321 ? NH1 ? G ARG 3  NH1 
57  1 Y 1 C ARG 321 ? NH2 ? G ARG 3  NH2 
58  1 Y 1 C THR 353 ? OG1 ? G THR 35 OG1 
59  1 Y 1 C THR 353 ? CG2 ? G THR 35 CG2 
60  1 Y 1 C GLU 354 ? CG  ? G GLU 36 CG  
61  1 Y 1 C GLU 354 ? CD  ? G GLU 36 CD  
62  1 Y 1 C GLU 354 ? OE1 ? G GLU 36 OE1 
63  1 Y 1 C GLU 354 ? OE2 ? G GLU 36 OE2 
64  1 Y 1 C LYS 356 ? CG  ? G LYS 38 CG  
65  1 Y 1 C LYS 356 ? CD  ? G LYS 38 CD  
66  1 Y 1 C LYS 356 ? CE  ? G LYS 38 CE  
67  1 Y 1 C LYS 356 ? NZ  ? G LYS 38 NZ  
68  1 Y 1 C LYS 393 ? CG  ? G LYS 75 CG  
69  1 Y 1 C LYS 393 ? CD  ? G LYS 75 CD  
70  1 Y 1 C LYS 393 ? CE  ? G LYS 75 CE  
71  1 Y 1 C LYS 393 ? NZ  ? G LYS 75 NZ  
72  1 Y 1 C ASP 399 ? CG  ? G ASP 81 CG  
73  1 Y 1 C ASP 399 ? OD1 ? G ASP 81 OD1 
74  1 Y 1 C ASP 399 ? OD2 ? G ASP 81 OD2 
75  1 Y 1 C LEU 400 ? CG  ? G LEU 82 CG  
76  1 Y 1 C LEU 400 ? CD1 ? G LEU 82 CD1 
77  1 Y 1 C LEU 400 ? CD2 ? G LEU 82 CD2 
78  1 Y 1 D GLN 319 ? CG  ? H GLN 1  CG  
79  1 Y 1 D GLN 319 ? CD  ? H GLN 1  CD  
80  1 Y 1 D GLN 319 ? OE1 ? H GLN 1  OE1 
81  1 Y 1 D GLN 319 ? NE2 ? H GLN 1  NE2 
82  1 Y 1 D SER 320 ? OG  ? H SER 2  OG  
83  1 Y 1 D ARG 321 ? CG  ? H ARG 3  CG  
84  1 Y 1 D ARG 321 ? CD  ? H ARG 3  CD  
85  1 Y 1 D ARG 321 ? NE  ? H ARG 3  NE  
86  1 Y 1 D ARG 321 ? CZ  ? H ARG 3  CZ  
87  1 Y 1 D ARG 321 ? NH1 ? H ARG 3  NH1 
88  1 Y 1 D ARG 321 ? NH2 ? H ARG 3  NH2 
89  1 Y 1 D LYS 324 ? CG  ? H LYS 6  CG  
90  1 Y 1 D LYS 324 ? CD  ? H LYS 6  CD  
91  1 Y 1 D LYS 324 ? CE  ? H LYS 6  CE  
92  1 Y 1 D LYS 324 ? NZ  ? H LYS 6  NZ  
93  1 Y 1 D HIS 392 ? CG  ? H HIS 74 CG  
94  1 Y 1 D HIS 392 ? ND1 ? H HIS 74 ND1 
95  1 Y 1 D HIS 392 ? CD2 ? H HIS 74 CD2 
96  1 Y 1 D HIS 392 ? CE1 ? H HIS 74 CE1 
97  1 Y 1 D HIS 392 ? NE2 ? H HIS 74 NE2 
98  1 Y 1 D LYS 393 ? CG  ? H LYS 75 CG  
99  1 Y 1 D LYS 393 ? CD  ? H LYS 75 CD  
100 1 Y 1 D LYS 393 ? CE  ? H LYS 75 CE  
101 1 Y 1 D LYS 393 ? NZ  ? H LYS 75 NZ  
102 1 Y 1 D SER 394 ? OG  ? H SER 76 OG  
1  1 Y 1 A ASP 399 ? E ASP 81 
2  1 Y 1 A LEU 400 ? E LEU 82 
3  1 Y 1 B GLN 319 ? F GLN 1  
4  1 Y 1 B LYS 395 ? F LYS 77 
5  1 Y 1 B SER 396 ? F SER 78 
6  1 Y 1 B LEU 397 ? F LEU 79 
7  1 Y 1 B LYS 398 ? F LYS 80 
8  1 Y 1 B ASP 399 ? F ASP 81 
9  1 Y 1 B LEU 400 ? F LEU 82 
10 1 Y 1 D LYS 395 ? H LYS 77 
11 1 Y 1 D SER 396 ? H SER 78 
12 1 Y 1 D LEU 397 ? H LEU 79 
13 1 Y 1 D LYS 398 ? H LYS 80 
14 1 Y 1 D ASP 399 ? H ASP 81 
15 1 Y 1 D LEU 400 ? H LEU 82 
1AM9 'double helix'        
1AM9 'b-form double helix' 
1 A DT 1  1_555 D DA 21 1_555 0.336  -0.318 0.383  -5.573 -5.713  1.036   1  E_DT1:DA76_H  E 1  ? H 76 ? 20 1 
1 A DT 2  1_555 D DA 20 1_555 0.392  -0.571 0.191  -0.277 -5.162  -2.525  2  E_DT2:DA75_H  E 2  ? H 75 ? 20 1 
1 A DG 3  1_555 D DC 19 1_555 0.410  -0.451 0.104  -0.931 -6.723  -1.785  3  E_DG3:DC74_H  E 3  ? H 74 ? 19 1 
1 A DC 4  1_555 D DG 18 1_555 -0.687 -0.398 0.139  -3.381 -6.877  -6.835  4  E_DC4:DG73_H  E 4  ? H 73 ? 19 1 
1 A DA 5  1_555 D DT 17 1_555 0.810  -0.404 0.000  6.663  -14.562 -11.340 5  E_DA5:DT72_H  E 5  ? H 72 ? 20 1 
1 A DG 6  1_555 D DC 16 1_555 -0.076 -0.316 0.275  -2.029 -14.033 -0.878  6  E_DG6:DC71_H  E 6  ? H 71 ? 19 1 
1 A DT 7  1_555 D DA 15 1_555 0.089  -0.127 0.232  -5.332 -13.129 1.220   7  E_DT7:DA70_H  E 7  ? H 70 ? 20 1 
1 A DG 8  1_555 D DC 14 1_555 0.117  -0.415 0.174  4.273  -1.546  -5.875  8  E_DG8:DC69_H  E 8  ? H 69 ? 19 1 
1 A DG 9  1_555 D DC 13 1_555 0.083  -0.249 -0.149 -5.854 -6.178  -3.200  9  E_DG9:DC68_H  E 9  ? H 68 ? 19 1 
1 A DG 10 1_555 D DC 12 1_555 0.280  -0.513 -0.003 -1.234 -13.725 -3.406  10 E_DG10:DC67_H E 10 ? H 67 ? 19 1 
1 A DG 11 1_555 D DC 11 1_555 0.007  -0.344 -0.147 -6.876 -10.941 -1.744  11 E_DG11:DC66_H E 11 ? H 66 ? 19 1 
1 A DT 12 1_555 D DA 10 1_555 -0.305 -0.300 0.182  -4.425 -8.079  -3.979  12 E_DT12:DA65_H E 12 ? H 65 ? 20 1 
1 A DG 13 1_555 D DC 9  1_555 0.128  -0.328 -0.032 7.219  -11.790 -3.988  13 E_DG13:DC64_H E 13 ? H 64 ? 19 1 
1 A DA 14 1_555 D DT 8  1_555 -0.280 -0.447 -0.068 5.563  -13.323 -2.604  14 E_DA14:DT63_H E 14 ? H 63 ? 20 1 
1 A DT 15 1_555 D DA 7  1_555 0.014  -0.246 0.281  -0.205 -13.118 2.049   15 E_DT15:DA62_H E 15 ? H 62 ? 20 1 
1 A DC 16 1_555 D DG 6  1_555 0.006  -0.470 0.085  -5.719 -15.413 -4.465  16 E_DC16:DG61_H E 16 ? H 61 ? 19 1 
1 A DT 17 1_555 D DA 5  1_555 -0.372 -0.308 -0.066 -5.086 -7.930  -7.267  17 E_DT17:DA60_H E 17 ? H 60 ? 20 1 
1 B DC 1  1_555 D DG 4  1_555 -0.015 -0.299 0.113  -4.146 -6.563  -4.184  18 F_DC18:DG59_H F 18 ? H 59 ? 19 1 
1 B DA 2  1_555 D DT 3  1_555 0.938  -0.523 -0.083 -7.486 -6.700  0.854   19 F_DA19:DT58_H F 19 ? H 58 ? 20 1 
1 B DT 3  1_555 D DA 2  1_555 -0.220 -0.471 -0.018 5.225  -5.878  -3.022  20 F_DT20:DA57_H F 20 ? H 57 ? 20 1 
1 B DG 4  1_555 D DC 1  1_555 0.113  -0.309 0.182  2.922  -11.078 -3.267  21 F_DG21:DC56_H F 21 ? H 56 ? 19 1 
1 B DA 5  1_555 C DT 17 1_555 0.563  -0.318 0.076  4.489  -8.664  -3.137  22 F_DA22:DT55_G F 22 ? G 55 ? 20 1 
1 B DG 6  1_555 C DC 16 1_555 -0.106 -0.271 -0.102 -0.272 -10.289 -3.125  23 F_DG23:DC54_G F 23 ? G 54 ? 19 1 
1 B DA 7  1_555 C DT 15 1_555 -0.022 -0.370 0.250  -2.125 -14.745 3.605   24 F_DA24:DT53_G F 24 ? G 53 ? 20 1 
1 B DT 8  1_555 C DA 14 1_555 0.190  -0.297 0.025  -4.192 -20.201 -4.854  25 F_DT25:DA52_G F 25 ? G 52 ? 20 1 
1 B DC 9  1_555 C DG 13 1_555 -0.027 -0.296 0.054  -5.659 -11.537 -6.566  26 F_DC26:DG51_G F 26 ? G 51 ? 19 1 
1 B DA 10 1_555 C DT 12 1_555 0.068  -0.258 0.155  7.110  -9.977  -4.953  27 F_DA27:DT50_G F 27 ? G 50 ? 20 1 
1 B DC 11 1_555 C DG 11 1_555 0.355  -0.415 -0.365 11.744 -10.299 -2.970  28 F_DC28:DG49_G F 28 ? G 49 ? 19 1 
1 B DC 12 1_555 C DG 10 1_555 0.137  -0.420 0.237  -4.028 -12.762 -1.747  29 F_DC29:DG48_G F 29 ? G 48 ? 19 1 
1 B DC 13 1_555 C DG 9  1_555 -0.116 -0.372 0.040  1.402  -7.042  -2.810  30 F_DC30:DG47_G F 30 ? G 47 ? 19 1 
1 B DC 14 1_555 C DG 8  1_555 -0.035 -0.353 0.174  0.001  -5.920  -2.390  31 F_DC31:DG46_G F 31 ? G 46 ? 19 1 
1 B DA 15 1_555 C DT 7  1_555 0.042  -0.338 0.267  2.978  -10.268 -0.657  32 F_DA32:DT45_G F 32 ? G 45 ? 20 1 
1 B DC 16 1_555 C DG 6  1_555 -0.340 -0.349 0.154  -0.459 -9.422  -1.997  33 F_DC33:DG44_G F 33 ? G 44 ? 19 1 
1 B DT 17 1_555 C DA 5  1_555 -1.068 -0.301 -0.015 -2.159 -13.319 -10.210 34 F_DT34:DA43_G F 34 ? G 43 ? 20 1 
1 B DG 18 1_555 C DC 4  1_555 -0.543 -0.637 -0.275 -0.196 -5.848  -6.104  35 F_DG35:DC42_G F 35 ? G 42 ? 19 1 
1 B DC 19 1_555 C DG 3  1_555 0.344  -0.430 0.310  -3.937 -4.229  -2.791  36 F_DC36:DG41_G F 36 ? G 41 ? 19 1 
1 B DA 20 1_555 C DT 2  1_555 -1.070 -0.772 0.272  2.885  -4.077  2.745   37 F_DA37:DT40_G F 37 ? G 40 ? 20 1 
1 B DA 21 1_555 C DT 1  1_555 -0.280 -0.513 0.463  5.563  -5.574  -2.464  38 F_DA38:DT39_G F 38 ? G 39 ? 20 1 
1 A DT 1  1_555 D DA 21 1_555 A DT 2  1_555 D DA 20 1_555 -0.407 0.892  3.252 1.719  3.527  32.822 0.969  1.008  3.302 6.213  
-3.028 33.049 1  EE_DT1DT2:DA75DA76_HH   E 1  ? H 76 ? E 2  ? H 75 ? 
1 A DT 2  1_555 D DA 20 1_555 A DG 3  1_555 D DC 19 1_555 -0.021 2.407  3.264 -1.672 -1.667 45.735 3.236  -0.116 3.178 -2.143 
2.150  45.792 2  EE_DT2DG3:DC74DA75_HH   E 2  ? H 75 ? E 3  ? H 74 ? 
1 A DG 3  1_555 D DC 19 1_555 A DC 4  1_555 D DG 18 1_555 -0.276 0.810  3.321 -1.349 -3.421 33.099 1.986  0.255  3.232 -5.981 
2.359  33.297 3  EE_DG3DC4:DG73DC74_HH   E 3  ? H 74 ? E 4  ? H 73 ? 
1 A DC 4  1_555 D DG 18 1_555 A DA 5  1_555 D DT 17 1_555 -0.537 1.125  3.064 2.648  3.011  48.174 1.154  0.850  3.093 3.681  
-3.237 48.330 4  EE_DC4DA5:DT72DG73_HH   E 4  ? H 73 ? E 5  ? H 72 ? 
1 A DA 5  1_555 D DT 17 1_555 A DG 6  1_555 D DC 16 1_555 0.835  -0.589 3.447 -1.995 4.289  29.975 -2.017 -2.011 3.272 8.227  
3.827  30.338 5  EE_DA5DG6:DC71DT72_HH   E 5  ? H 72 ? E 6  ? H 71 ? 
1 A DG 6  1_555 D DC 16 1_555 A DT 7  1_555 D DA 15 1_555 0.247  -0.676 3.314 1.162  2.560  29.835 -1.838 -0.236 3.253 4.958  
-2.251 29.965 6  EE_DG6DT7:DA70DC71_HH   E 6  ? H 71 ? E 7  ? H 70 ? 
1 A DT 7  1_555 D DA 15 1_555 A DG 8  1_555 D DC 14 1_555 0.015  -0.403 2.929 -0.895 7.958  32.231 -1.883 -0.158 2.753 14.065 
1.583  33.186 7  EE_DT7DG8:DC69DA70_HH   E 7  ? H 70 ? E 8  ? H 69 ? 
1 A DG 8  1_555 D DC 14 1_555 A DG 9  1_555 D DC 13 1_555 -0.431 -0.666 3.513 1.846  3.748  36.507 -1.599 0.951  3.405 5.958  
-2.935 36.738 8  EE_DG8DG9:DC68DC69_HH   E 8  ? H 69 ? E 9  ? H 68 ? 
1 A DG 9  1_555 D DC 13 1_555 A DG 10 1_555 D DC 12 1_555 0.037  -0.247 3.187 -1.795 9.065  31.047 -1.989 -0.372 2.991 16.482 
3.264  32.360 9  EE_DG9DG10:DC67DC68_HH  E 9  ? H 68 ? E 10 ? H 67 ? 
1 A DG 10 1_555 D DC 12 1_555 A DG 11 1_555 D DC 11 1_555 -0.197 -0.786 3.330 1.107  2.001  37.074 -1.504 0.459  3.277 3.144  
-1.739 37.142 10 EE_DG10DG11:DC66DC67_HH E 10 ? H 67 ? E 11 ? H 66 ? 
1 A DG 11 1_555 D DC 11 1_555 A DT 12 1_555 D DA 10 1_555 -0.415 -0.644 3.173 -1.045 2.837  29.908 -1.802 0.594  3.112 5.479  
2.018  30.057 11 EE_DG11DT12:DA65DC66_HH E 11 ? H 66 ? E 12 ? H 65 ? 
1 A DT 12 1_555 D DA 10 1_555 A DG 13 1_555 D DC 9  1_555 -0.160 0.478  3.010 -0.929 5.597  35.838 0.037  0.136  3.051 9.026  
1.499  36.269 12 EE_DT12DG13:DC64DA65_HH E 12 ? H 65 ? E 13 ? H 64 ? 
1 A DG 13 1_555 D DC 9  1_555 A DA 14 1_555 D DT 8  1_555 -0.497 -0.227 3.239 -2.342 4.268  32.022 -1.154 0.482  3.210 7.682  
4.215  32.381 13 EE_DG13DA14:DT63DC64_HH E 13 ? H 64 ? E 14 ? H 63 ? 
1 A DA 14 1_555 D DT 8  1_555 A DT 15 1_555 D DA 7  1_555 0.694  -0.779 3.331 -2.033 0.049  32.079 -1.416 -1.621 3.281 0.088  
3.674  32.142 14 EE_DA14DT15:DA62DT63_HH E 14 ? H 63 ? E 15 ? H 62 ? 
1 A DT 15 1_555 D DA 7  1_555 A DC 16 1_555 D DG 6  1_555 -0.218 -0.647 3.213 1.346  0.436  39.686 -1.002 0.475  3.197 0.642  
-1.982 39.710 15 EE_DT15DC16:DG61DA62_HH E 15 ? H 62 ? E 16 ? H 61 ? 
1 A DC 16 1_555 D DG 6  1_555 A DT 17 1_555 D DA 5  1_555 0.136  -0.121 3.221 1.812  4.556  35.053 -0.859 0.039  3.184 7.519  
-2.990 35.384 16 EE_DC16DT17:DA60DG61_HH E 16 ? H 61 ? E 17 ? H 60 ? 
1 A DT 17 1_555 D DA 5  1_555 B DC 1  1_555 D DG 4  1_555 0.288  -0.718 3.195 -1.896 -0.504 28.197 -1.356 -1.020 3.182 -1.034 
3.886  28.263 17 EF_DT17DC18:DG59DA60_HH E 17 ? H 60 ? F 18 ? H 59 ? 
1 B DC 1  1_555 D DG 4  1_555 B DA 2  1_555 D DT 3  1_555 0.055  -0.956 3.268 4.121  10.890 37.893 -2.641 0.384  2.886 16.305 
-6.170 39.579 18 FF_DC18DA19:DT58DG59_HH F 18 ? H 59 ? F 19 ? H 58 ? 
1 B DA 2  1_555 D DT 3  1_555 B DT 3  1_555 D DA 2  1_555 -0.149 -0.764 2.958 -0.818 4.726  25.959 -2.788 0.132  2.781 10.408 
1.802  26.391 19 FF_DA19DT20:DA57DT58_HH F 19 ? H 58 ? F 20 ? H 57 ? 
1 B DT 3  1_555 D DA 2  1_555 B DG 4  1_555 D DC 1  1_555 0.129  -1.089 3.234 -1.672 8.057  35.072 -2.854 -0.435 2.912 13.146 
2.729  35.995 20 FF_DT20DG21:DC56DA57_HH F 20 ? H 57 ? F 21 ? H 56 ? 
1 B DG 4  1_555 D DC 1  1_555 B DA 5  1_555 C DT 17 1_555 -0.049 -0.545 3.178 2.582  0.095  28.952 -1.105 0.648  3.160 0.189  
-5.152 29.064 21 FF_DG21DA22:DT55DC56_GH F 21 ? H 56 ? F 22 ? G 55 ? 
1 B DA 5  1_555 C DT 17 1_555 B DG 6  1_555 C DC 16 1_555 -0.383 -0.210 3.380 1.160  3.665  32.680 -1.013 0.880  3.322 6.484  
-2.053 32.899 22 FF_DA22DG23:DC54DT55_GG F 22 ? G 55 ? F 23 ? G 54 ? 
1 B DG 6  1_555 C DC 16 1_555 B DA 7  1_555 C DT 15 1_555 0.183  -0.694 3.113 -2.268 2.404  40.182 -1.263 -0.508 3.053 3.492  
3.294  40.312 23 FF_DG23DA24:DT53DC54_GG F 23 ? G 54 ? F 24 ? G 53 ? 
1 B DA 7  1_555 C DT 15 1_555 B DT 8  1_555 C DA 14 1_555 -0.857 -0.718 3.233 -0.999 1.246  31.177 -1.568 1.405  3.228 2.316  
1.856  31.217 24 FF_DA24DT25:DA52DT53_GG F 24 ? G 53 ? F 25 ? G 52 ? 
1 B DT 8  1_555 C DA 14 1_555 B DC 9  1_555 C DG 13 1_555 0.288  -0.375 3.246 1.443  0.109  32.343 -0.691 -0.264 3.255 0.195  
-2.589 32.375 25 FF_DT25DC26:DG51DA52_GG F 25 ? G 52 ? F 26 ? G 51 ? 
1 B DC 9  1_555 C DG 13 1_555 B DA 10 1_555 C DT 12 1_555 0.324  0.546  2.928 2.297  5.665  36.733 0.169  -0.230 2.990 8.913  
-3.614 37.221 26 FF_DC26DA27:DT50DG51_GG F 26 ? G 51 ? F 27 ? G 50 ? 
1 B DA 10 1_555 C DT 12 1_555 B DC 11 1_555 C DG 11 1_555 0.466  -0.615 3.182 3.529  1.413  30.730 -1.418 -0.208 3.183 2.653  
-6.627 30.959 27 FF_DA27DC28:DG49DT50_GG F 27 ? G 50 ? F 28 ? G 49 ? 
1 B DC 11 1_555 C DG 11 1_555 B DC 12 1_555 C DG 10 1_555 0.300  -0.612 3.550 -3.902 3.436  39.483 -1.326 -0.926 3.443 5.059  
5.745  39.811 28 FF_DC28DC29:DG48DG49_GG F 28 ? G 49 ? F 29 ? G 48 ? 
1 B DC 12 1_555 C DG 10 1_555 B DC 13 1_555 C DG 9  1_555 -0.034 -0.589 3.201 3.459  8.013  27.213 -2.933 0.819  2.887 16.500 
-7.122 28.553 29 FF_DC29DC30:DG47DG48_GG F 29 ? G 48 ? F 30 ? G 47 ? 
1 B DC 13 1_555 C DG 9  1_555 B DC 14 1_555 C DG 8  1_555 0.440  -0.566 3.194 0.010  5.818  37.458 -1.590 -0.677 3.075 8.994  
-0.015 37.891 30 FF_DC30DC31:DG46DG47_GG F 30 ? G 47 ? F 31 ? G 46 ? 
1 B DC 14 1_555 C DG 8  1_555 B DA 15 1_555 C DT 7  1_555 -0.278 -0.500 3.174 -0.244 7.577  32.197 -2.102 0.450  2.984 13.430 
0.433  33.054 31 FF_DC31DA32:DT45DG46_GG F 31 ? G 46 ? F 32 ? G 45 ? 
1 B DA 15 1_555 C DT 7  1_555 B DC 16 1_555 C DG 6  1_555 -0.023 -0.825 3.319 -1.049 1.159  26.898 -2.069 -0.222 3.280 2.488  
2.253  26.942 32 FF_DA32DC33:DG44DT45_GG F 32 ? G 45 ? F 33 ? G 44 ? 
1 B DC 16 1_555 C DG 6  1_555 B DT 17 1_555 C DA 5  1_555 -0.627 -0.561 3.309 2.941  2.950  30.885 -1.604 1.725  3.171 5.508  
-5.491 31.158 33 FF_DC33DT34:DA43DG44_GG F 33 ? G 44 ? F 34 ? G 43 ? 
1 B DT 17 1_555 C DA 5  1_555 B DG 18 1_555 C DC 4  1_555 0.516  0.968  3.319 1.499  5.033  39.521 0.818  -0.578 3.428 7.404  
-2.204 39.854 34 FF_DT34DG35:DC42DA43_GG F 34 ? G 43 ? F 35 ? G 42 ? 
1 B DG 18 1_555 C DC 4  1_555 B DC 19 1_555 C DG 3  1_555 -0.142 0.828  3.356 -4.257 -0.325 41.979 1.184  -0.253 3.348 -0.453 
5.924  42.186 35 FF_DG35DC36:DG41DC42_GG F 35 ? G 42 ? F 36 ? G 41 ? 
1 B DC 19 1_555 C DG 3  1_555 B DA 20 1_555 C DT 2  1_555 0.767  2.228  3.122 2.549  -3.827 43.526 3.330  -0.802 2.964 -5.143 
-3.426 43.756 36 FF_DC36DA37:DT40DG41_GG F 36 ? G 41 ? F 37 ? G 40 ? 
1 B DA 20 1_555 C DT 2  1_555 B DA 21 1_555 C DT 1  1_555 0.042  0.881  3.386 -1.850 1.440  34.156 1.260  -0.375 3.412 2.448  
3.146  34.234 37 FF_DA37DA38:DT39DT40_GG F 37 ? G 40 ? F 38 ? G 39 ? 
5 water           HOH 