>1efa_D mol:na length:21  DNA (5'-D(*GP*AP*AP*T*TP*GP*TP*GP*AP*GP*CP*GP*CP*TP*CP*AP*CP*AP*AP*TP*T)-3')
GAATTGTGAGCGCTCACAATT