>4v6x_A8 mol:na length:157  5.8S ribosomal RNA
CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGCUGCGA
GAAUUAAUGUGAAUUGCAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCC
CGGGUUCCUCCCGGGGCUACGCCUGUCUGAGCGUCGCUU