>6s1m_P mol:na length:25  DNA primer
AGCTATGACCATGATTACGAATTGC