4IHV |
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) |
date |
2012-12-19
|
authors | Hancock, S.P., Cascio, D., Johnson, R.C. |
compound |
source |
symmetry | |
|
crystal cell |
length a |
length b |
length c |
angle alpha |
angle beta |
angle gamma |
|
|
|
|
|
|
|
method | X-Ray Diffraction | resolution | 2.72 |
Gene | ECDH1ME8569 ; ECDH1 |
Gene Ontology |
Chain | Function | Process | Component | A, B |
|
|
|
|
Primary reference | Control of DNA minor groove width and Fis protein binding by the purine 2-amino group., Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC, Nucleic Acids Res. 2013 May 9. PMID:23661683 |