4IHV Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) date 2012-12-19
authors Hancock, S.P., Cascio, D., Johnson, R.C.
compound source
symmetry
R_factor
R_Free 0.2575
crystal
cell
length a length b length c angle alpha angle beta angle gamma
method X-Ray Diffractionresolution 2.72
Gene ECDH1ME8569 ; ECDH1
Gene
Ontology
ChainFunctionProcessComponent
A, B


Primary referenceControl of DNA minor groove width and Fis protein binding by the purine 2-amino group., Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC, Nucleic Acids Res. 2013 May 9. PMID:23661683
Data retrieval
  • Asymmetric unit, PDB entry: [header only] [complete with coordinates] (57 Kb) [Save to disk]
  • Biological Unit Coordinates (4ihv.pdb1.gz) 53 Kb
  • CSU: Contacts of Structural Units for 4IHV
  • Structure Factors (125 Kb)
  • Retrieve 4IHV in mmCIF format [Save to disk]
  • SEQRES to COORDINATES correlation for 4IHV from S2C, [Save to disk]
  • Re-refined 4ihv structure from PDB_REDO, a databank with updated and optimised macromolecular X-ray diffraction structure models
  • View 4IHV in 3D
  • Proteopedia, because life has more than 2D.
  • On Jmol, a nice Rasmol like molecule viewer. This is good for easiest viewing of basic structure.
  • On FirstGlance, an excellent tool for a guided tour on the structure components, by E. Martz.
  • Visual 3D analysis of 4IHV
  • Ramachandran plot from PDBSum
  • Structure-derived information
  • Electron Density related parameters from EDS Electron Density Server, at Upsala
  • Dipole moment, from Dipole Server at Weizmann Institute
  • 3D motif for 4IHV, from MSDmotif at EBI
  • Sequence-derived information
  • View one-letter amino acid or nucleotide sequence for each chain: [4ihv] [4ihv_D] [4ihv_B] [4ihv_A] [4ihv_C]
  • SWISS-PROT database:
  • Domain organization of by SWISSPFAM
  • Other resources with information on 4IHV
  • Community annotation for 4IHV at PDBWiki (http://pdbwiki.org)

  • You may enter another PDB ID code
    Go [Back], to the [PDB Lite page], to the [OCA Search page] or to the [PDB Home page]
    OCA© by Jaime Prilusky, 1996-2014,2022
    Bioinformatics Unit
    Weizmann Institute of Science